Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coastal reefs to at least 30 m (Ref. 9710). Adults often found in pairs inside caves (Ref. 9710, 48636). Juveniles settle in very shallow inshore habitats with short filamentous algae growth on rock or dead coral substrates (Ref. 48636). Feeds on sponges and tunicates (Ref. 48391). Undergoes a complete color transformation from the juvenile to adult stage. Regularly exported, e.g. from Sri Lanka, for the aquarium trade.
  • Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pomacanthus annularis live in the Indo-Pacific region ranging from Sri Lanka to the Solomon Islands and from the Philippines to the northern tip of Australia. Normally this range is from 25 degrees north to 25 degrees south (Agbayani, 2002; Heemstra, 1986).

Biogeographic Regions: oriental (Native ); australian (Native ); indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This wide ranging species is distributed throughout the Indo-west Pacific region. It ranges from coastal East Africa (north of KwaZulu-Natal, South Africa) in the west, through the Indian Ocean to Indonesia, the island of New Guinea (Indonesia and Papua New Guinea), and the Solomon Islands in the east. It ranges from as far north as southern Japan to the island of New Caledonia (France) in the south (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). It has been recorded at depths of 1-60 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East coast of Africa, throughout Indonesia and New Guinea to New Caledonia, north to southern Japan.
  • Pyle, R. 2001 Pomacanthidae: Angelfishes. p. 3266-3286. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 5. Bony fishes part 3 (Menidae to Pomacentridae). Rome, FAO. (Ref. 48391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult P. annularis are a dark orange to brown color with white caudal fin, grow up to 12 inches in length, head to caudal fin and are monomorphic between sexes. Soft dorsal spine rays, numbering 20-21 are at times longer than normal so that they extend further than the rest of the dorsal spine rays. There are also 13 dorsal spines with the dorsal fins being continuous, three anal spines and 20 soft anal rays (Agbayani, 2002). Adult bluering angelfish have blue, horizontal curved lines that extend from the back of the head/pelvic fin area to the dorsal and caudal fins. Also there are two blue stripes that cross the face, one through the eye and the other below. Finally, the blue ring (where it gets its common name) is above and behind the operculum (Agbayani, 2002; Nelson, 1994; Thresher, 1984; Heemstra, 1986).

Members of the family Pomacanthidae were classified until recently in a family with butterfly fishes because they share many features "such as deep compressed bodies, ctenoid scales which extend out onto the median fins, a small mouth with brush-like teeth. But differ from butterfly fishes, however, in having a long spine at the corner of the preopercle (also smaller spines on the preopercle, opercle, and preorbital) (Allen, 1994). Other differences include the presence of a snout in angelfish and a pelvic axillary process (Helfman et al., 1997).

Range length: 20 to 45 cm.

Average length: 30.5 cm.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 13; Dorsal soft rays (total): 20 - 21; Analspines: 3; Analsoft rays: 20
  • Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 450 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

45.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Juveniles black with alternating white and blue curved well-spaced stripes on the sides. Adults golden brown or orange with well-spaced curved horizontal stripes radiating from the pectoral-fin base area, running along the sides towards the posterior portion of the dorsal fin. Two similar blue stripes run horizontally across the face, one running through the eye, from above the snout to the edge of the operculum. A blue ring is behind and slightly above the edge of the operculum. Caudal fin is white with bright yellow margin (Ref. 4859). Body depth 1.5-1.6 in SL. Scales longitudinal series about 70 (Ref. 90102).
  • Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Undergoes a complete colour transformation from the juvenile to adult stage. Regularly exported, e.g. from Sri Lanka, for the aquarium trade.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

P. annularis is a tropical, marine (salt water) fish that lives around coastal rocky coral reefs and other hard bottom coastal areas. In their natural habitat the adults are normally found from 5-15 meters in depth, but as far down as 30 meters. The juveniles are usually at the upper range of the adults and sometimes are in even shallower water. When kept as aquarium fish, optimal temperature is 26 degrees Celsius with a pH of 8 and lots of light.

The adults of the genus Pomacanthus are normally haremic; one male defends a territory with two to five females living with the male. They are usually found alone or in pairs in caves in the rocky/coral oceanic bottom (Steen, 1978; Tullock, 1996; Agbayani, 2002).

Range depth: 3 to 30 m.

Average depth: 5-15 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: benthic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Populations of this species inhabit coastal reefs, and is sometimes encountered in caves, on wrecks, or underneath jetties in sheltered coves or harbors (G.R. Allen pers. comm. 2006). It is frequently seen in murky water. It is most usually encountered singly or in pairs. This species feeds on zooplankton, sponges, and tunicates (Pyle 2001, G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 60 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 4 - 37
  Temperature range (°C): 28.662 - 29.107
  Nitrate (umol/L): 0.372 - 0.553
  Salinity (PPS): 32.139 - 32.276
  Oxygen (ml/l): 4.149 - 4.481
  Phosphate (umol/l): 0.315 - 0.380
  Silicate (umol/l): 4.334 - 6.058

Graphical representation

Depth range (m): 4 - 37

Temperature range (°C): 28.662 - 29.107

Nitrate (umol/L): 0.372 - 0.553

Salinity (PPS): 32.139 - 32.276

Oxygen (ml/l): 4.149 - 4.481

Phosphate (umol/l): 0.315 - 0.380

Silicate (umol/l): 4.334 - 6.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

P. annularis are omnivorous, eating benthic invertebrates such as zooplankton, sponges, tunicates and coral polyps. Also these fish eat ascidians, algae, weeds, and nektonic fishes (Steen, 1978; Agbayani, 2002).

Animal Foods: cnidarians; other marine invertebrates

Plant Foods: leaves; algae

Primary Diet: carnivore (Piscivore , Eats other marine invertebrates); herbivore (Folivore , Algivore); omnivore ; planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Pomacanthus annularis preys on:
algae
marine invertebrates
Cnidaria

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The larvae hatch at sunset the day after the courtship ritual of the parents and swim with the plankton for a month before developing into juveniles. This type of fish is not able to reproduce well in captivity because the larvae are unable to survive. The fish are considered protogynous hermaphrodites, meaning at the beginning of life all are females. Then as development continues the larger fish become males (Tullock, 1996).

Also during development a drastic change occurs in the coloration patterns of juvenile P. annularis to the adult. The juveniles start out with alternating, vertical blue and white stripes on a black background. This coloration pattern is similar to all large angelfish and P. annularis juveniles often are misidentified as P. chrysurus. However, the caudal fin is transparent in bluering angelfish but is yellow in P. chrysurus. Then as they mature into adults, the vertical blue and white stripes disappear, the caudal fin whitens, and the background becomes a dark orange to brown. Horizontal, curved blue lines also appear and run from the back of the head/pelvic fin area to the caudal and dorsal fins (Agbayani, 2002; Heemstra, 1986).

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Some large angelfish, such as the P. annularis have been recorded to live up to 25 years in an aquarium (www.sphyraena.com/library/angelfish.html).

Range lifespan

Status: captivity:
25 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating System: polygynous

For members of the genus Pomacanthus, spawning normally begins with the onset of dusk and is thought to be triggered by the decrease in light. However it is not known whether there is a correlation between time of year or with the lunar cycle and the onset of spawning in angelfish. The adults have a courtship ritual that ends in the male and female slowly swimming toward the surface of the water and releasing eggs and sperm. The larvae then swim with the plankton for a month before continuing development. Spawning is thought to take place between only one male and one female at a time, but males possibly mate with more than one female with in the group (Thresher, 1984; Agbayani, 2002; Tullock, 2002).

Range gestation period: 15 to 24 hours.

Average gestation period: 20 hours.

Key Reproductive Features: year-round breeding ; sequential hermaphrodite (Protogynous ); sexual ; fertilization (External )

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus annularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTTGGTGCTTGAGCCGGAATGGTGGGCACAGCTTTAAGCCTACTAATTCGAGCCGAGCTAAATCAACCAGGCAGTCTTCTCGGGGACGACCAGATCTACAATGTTATCGTTACAGCACACGCATTCGTAATAATCTTTTTTATAGTAATGCCAGCTATAATTGGGGGATTCGGGAACTGACTAGTCCCGCTGATAATTGGAGCCCCAGACATGGCATTTCCTCGAATAAACAATATAAGCTTTTGGCTTCTGCCCCCTTCCCTCCTCCTTCTCCTTGCTTCCGCTGGAGTAGAAGCCGGAGCCGGGACTGGATGGACAGTTTACCCGCCCCTGGCCGGCAATTTAGCCCATGCAGGAGCATCCGTAGACTTAACCATTTTCTCCCTTCATCTGGCTGGGATTTCCTCAATTCTTGGGGCCATCAACTTTATTACAACCATTATTAACATGAAACCTCCCGCTATCTCACAATATCAAACCCCGCTATTTGTATGAGCCGTTCTCATCACCGCAGTACTGCTTCTTCTTTCTCTCCCCGTCCTTGCTGCTGGCATCACAATACTTCTCACAGACCGAAACCTCAACACCACCTTTTTTGATCCTGCAGGCGGGGGAGACCCAATCCTTTACCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus annularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large overall population and no apparent major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations. Steene (1978) suggests that the species is rare in the eastern portion of its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collecting is limited and is not considered to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within a number of marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bluering angelfish is kept as an aquarium fish and is exported regularly from Sri Lanka (Ceylon) to the US and Europe (Heemstra, 1986; Agbayani, 2002).

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: of no interest; aquarium: commercial
  • Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blue ring angelfish

The bluering angelfish (Pomacanthus annularis) is an angelfish of the family Pomacanthidae, found in the Indo-West Pacific oceans from East Africa, throughout Indonesia and New Guinea to New Caledonia, north to southern Japan.

In the aquarium[edit source | edit]

It is highly sought after and prized member of the Pomacanthus genus, composed of large marine angelfish. Bluering angelfish can reach up to 12 inches in the wild and often obtain lengths near that in captivity.

It bears a considerable resemblance to the Emperor Angelfish in that it undergoes changes in coloring in its development from youth to maturity. The young of the blueeing angelfish are at first a dark blue, almost black, with broad turquoise and white vertical stripes. Adults will exhibit a violet coloring with semicircular marks on the middle of the body.

In the aquarium bluering angelfish are algae grazers but consume fish and coral flesh as well. They are known to eat shrimps and nibble on both large polyped stony and small polyped stony corals. Overall most seasoned reef aquarists do not recommend keeping this species in a reef aquarium due to these habits.

References[edit source | edit]

In Prague Sea aguarium
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!