Overview

Comprehensive Description

Biology

Found near the coast and the surface (Ref. 11230). Occurs in estuaries (Ref. 7050). Probably important as forage fish. Nothing is known of the biology of this fish (Ref. 9760).
  • Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)   http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Indian Ocean and Western Pacific: India east to Vanuatu, north to Korea and Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: widely distributed throughout the southwest Pacific including Java, Borneo, Sumatra, Sulawesi, Viet Nam, Singapore, New Britain, Hermit Island Group, Papua New Guinea, Solomon Islands, Hong Kong and as far as Japan.
  • Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)   http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 5 - 8; Dorsal soft rays (total): 8 - 10; Analspines: 1; Analsoft rays: 10 - 13
  • Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)   http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 9760))
  • Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)   http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Free edge of premaxilla densely covered with minute shagreen denticles. Coronoid process of dentary not rounded as in other Hypoatherina species (Ref. 9760). Body covered by large round scales, head is nude except opercle is covered by scales. Silver white colored body (Ref. 41252).
  • Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)   http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Atherina valenciennesi
Catalog Number: USNM 143716
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Bleeker
Locality: D.E.I., Java, Batavia, Java, Indonesia, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Frequently a coastal fish in Southern Japanese and East China sea (Ref. 9137). Inhabits coral reefs (Ref. 58534).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypoatherina valenciennei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATTCGGGCAGAACTAAACCAACCAGGCTCTCTCCTTGGAGACGACCAGATCTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTGATCCCCCTTATGATGGGGGCCCCTGACATGGCATTCCCTCGAATGAATAATATGAGCTTCTGACTTCTGCCCCCCTCATTCCTTCTTCTTCTGGCCTCCTCTGGTGTTGAAGCCGGGGCTGGAACAGGTTGAACAGTTTATCCTCCCCTAGCCGGCAACCTGGCCCACGCCGGAGCGTCTGTAGACCTAACTATTTTCTCTCTTCATTTAGCAGGTGTTTCATCAATCCTCGGAGCCATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCCATCTCACAATATCAAACACCCCTATTCGTCTGAGCAGTCCTAATTACTGCCGTACTTCTTCTACTTTCTCTTCCAGTTCTAGCTGCCGGCATTACTATGCTACTAACAGACCGAAACCTAAATACCACCTTCTTTGACCCTGCCGGAGGGGGAGATCCCATTCTTTACCAGCATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypoatherina valenciennei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!