Overview
Comprehensive Description
Biology
Found near the coast and the surface (Ref. 11230). Occurs in estuaries (Ref. 7050). Probably important as forage fish. Nothing is known of the biology of this fish (Ref. 9760).
-
Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)
http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303
Trusted
Distribution
Eastern Indian Ocean and Western Pacific: India east to Vanuatu, north to Korea and Japan.
Trusted
Indo-West Pacific: widely distributed throughout the southwest Pacific including Java, Borneo, Sumatra, Sulawesi, Viet Nam, Singapore, New Britain, Hermit Island Group, Papua New Guinea, Solomon Islands, Hong Kong and as far as Japan.
-
Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)
http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303
Trusted
Physical Description
Morphology
Dorsal spines (total): 5 - 8; Dorsal soft rays (total): 8 - 10; Analspines: 1; Analsoft rays: 10 - 13
-
Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)
http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303
Trusted
Size
Max. size
12.0 cm TL (male/unsexed; (Ref. 9760))
-
Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)
http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303
Trusted
Diagnostic Description
Free edge of premaxilla densely covered with minute shagreen denticles. Coronoid process of dentary not rounded as in other Hypoatherina species (Ref. 9760). Body covered by large round scales, head is nude except opercle is covered by scales. Silver white colored body (Ref. 41252).
-
Ivantsoff, W. and L.E.L.M. Crowley 1999 Atherinidae. Silversides (or hardyheads). p. 2113-2139. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome. (Ref. 9760)
http://www.fishbase.org/references/FBRefSummary.php?id=9760&speccode=1303
Trusted
Type Information
Paratype for Atherina valenciennesi
Catalog Number: USNM 143716
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Bleeker
Locality: D.E.I., Java, Batavia, Java, Indonesia, Pacific
Catalog Number: USNM 143716
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Bleeker
Locality: D.E.I., Java, Batavia, Java, Indonesia, Pacific
- Paratype:
Trusted
Ecology
Habitat
Trophic Strategy
Frequently a coastal fish in Southern Japanese and East China sea (Ref. 9137). Inhabits coral reefs (Ref. 58534).
-
Masuda, H. and G.R. Allen 1993 Meeresfische der Welt - GroÃ-Indopazifische Region. Tetra Verlag, Herrenteich, Melle. 528 p. (Ref. 9137)
http://www.fishbase.org/references/FBRefSummary.php?id=9137&speccode=127
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Hypoatherina valenciennei
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATTCGGGCAGAACTAAACCAACCAGGCTCTCTCCTTGGAGACGACCAGATCTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTGATCCCCCTTATGATGGGGGCCCCTGACATGGCATTCCCTCGAATGAATAATATGAGCTTCTGACTTCTGCCCCCCTCATTCCTTCTTCTTCTGGCCTCCTCTGGTGTTGAAGCCGGGGCTGGAACAGGTTGAACAGTTTATCCTCCCCTAGCCGGCAACCTGGCCCACGCCGGAGCGTCTGTAGACCTAACTATTTTCTCTCTTCATTTAGCAGGTGTTTCATCAATCCTCGGAGCCATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCCATCTCACAATATCAAACACCCCTATTCGTCTGAGCAGTCCTAATTACTGCCGTACTTCTTCTACTTTCTCTTCCAGTTCTAGCTGCCGGCATTACTATGCTACTAACAGACCGAAACCTAAATACCACCTTCTTTGACCCTGCCGGAGGGGGAGATCCCATTCTTTACCAGCATCTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Hypoatherina valenciennei
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


