Overview

Comprehensive Description

Oxynotus centrina (Linnaeus, 1758)

Sea of Marmara : 1500-33 (1 spc.), 12.07.1995 , North-west offshore of Marmara Island , trawl , 159 m, L. Eryilmaz . Aegean Sea : 1500-571 (1 spc.), 01.09.2000 , Bozcaada Island, Mermer Burnu , trawl , 45 m, L. Eryilmaz . Mediterranean Sea : 1500-749 (1 spc.), March 2004 , Samandagi , trawl , 250 m, C. Dalyan . Istanbul Fish Market : 1500-28 (1 spc.), 09.04.1988 .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found on the outer continental shelf and upper slope (Ref. 5578). Depth range from 60-660 m (Ref. 247) and from 549-777 m in the eastern Ionian Sea (Ref. 56504). Feeds on polychaetes (Ref. 247) and sipunculids (apparenly a suction feeder which mainly feeds on worm-like prey), which are rapidly digested, and the rapid gastric evacuation could partially explain the vacuity of several guts; teleosts, crustaceans and echinoderms are considered as accessory prey items, thus recorded predation on egg cases of the smallspotted catshark Scyliorhinus canicula remains an occasional phenomenon (Ref. 81816). Ovoviviparous (Ref. 205). Utilized for fishmeal, oil, and smoked and dried salted for human consumption (Ref. 247).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eastern Atlantic and Mediterranean (entire coast from Straits of Gibraltar to Israel, but absent from the Black Sea), down to South Africa. Possibly off Mozambique in the Indian Ocean (Compagno in prep).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: Bay of Biscay and Mediterranean Sea to Senegal, north to Cornwall, England (apparently as a stray). Compagno et al. (Ref. 5578) reports this species as ranging south to Cape Point, South Africa but Springer 1990 (Ref. 10718) notes Bass et al. 1976 as considering specimens from Walvis Bay distinct from Oxynotus centrina calling attention to the considerably greater distance between dorsal fins in Mediterranean specimens than in specimens taken south of the equator.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean Sea, eastern Atlantic: northwestern North Sea and English Channel to Senegal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Bass, A.J., L.J.V. Compagno and P.C. Heemstra 1986 Squalidae. p. 49-62. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 6577)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 247))
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A small bizarre-looking shark with an unmistakable high body and bristly textured skin (Ref. 5578). Uniformly grey to grey-brown (Ref. 5578).
  • Bass, A.J., L.J.V. Compagno and P.C. Heemstra 1986 Squalidae. p. 49-62. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 6577)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found from 60 to 660 m depth (Serena 2005), but mostly below 100 m. Sion et al. (2004) stated a record of one specimen caught at 800m of depth. Found on coralline and muddy bottoms, mostly between 100 and 200 m depth in the northern Mediterranean sea.

Size at maturity has been reported at between 50 and 70 cm (Serena 2005) and Capapé et al. (1999) reported that a larger size at maturity in females (66 cm) than in males (60 cm). The species reaches a maximum size of 150 cm TL (Serena 2005, Compagno et al. 2005) although Compagno (in prep.) notes that most individuals are less than 100 cm. Indeed, Capapé et al. (1999) reported maximum lengths of 64 cm and 78 cm for males and females respectively.

Ovoviviparous, producing litters of 10 to 12 pups once a year (Capapé et al. 1999). Size at birth has been reported between from 21 to 24 cm [or <25 cm (Compagno et al. 2005)] with an average of 22.83 cm (Capapé et al.1999).

Feeds on polychaetes, crustaceans and molluscs (Compagno in prep).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 40 - 777 m (Ref. 56504)
  • Mytilineou, C., C.-Y. Politou, C. Papaconstantinou, S. Kavadas, G. D'Onghia and L. Sion 2005 Deep-water fish fauna in the Eastern Ionian Sea. Belg. J. Zool., 135(2):229-233. (Ref. 56504)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 100 - 644.5
  Temperature range (°C): 5.495 - 14.324
  Nitrate (umol/L): 2.233 - 33.014
  Salinity (PPS): 34.503 - 38.739
  Oxygen (ml/l): 1.902 - 4.609
  Phosphate (umol/l): 0.113 - 2.368
  Silicate (umol/l): 4.128 - 26.734

Graphical representation

Depth range (m): 100 - 644.5

Temperature range (°C): 5.495 - 14.324

Nitrate (umol/L): 2.233 - 33.014

Salinity (PPS): 34.503 - 38.739

Oxygen (ml/l): 1.902 - 4.609

Phosphate (umol/l): 0.113 - 2.368

Silicate (umol/l): 4.128 - 26.734
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 60 - 660m.
From 60 to 660 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, without a placenta, with about 7 or 8 young in a litter (Ref. 247). Distinct pairing with embrace (Ref. 205).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxynotus centrina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACAGCCCTTATTTACTTATTCGAACAGAATTAAGCCAACCTGGTACACTTTTAGGAGATGACCAAATCTACAATGTTATTGTAACTGCTCACGCTTTCGTGATAATCTTCTTTTTAGTAATGCCTGTAATAATTGGTGGGTTTGGGAATTGGCTAGTGCCTTTAATAATTGGCGCACCGGATATAGCTTTTCCACGAATAAATAATATAAGCTTCTGATTATTACCCCCCTCTCTCCTTTTACTTCTAGCCTCCGCTGGTGTAGAAGCGGGAGCCGGAACCGGATGAACAGTATATCCCCCTCTTGCGAGCAATATAGCTCACGCAGGAGCATCTGTAGATTTAGCCATCTTTTCCCTTCATTTGGCCGGTATTTCCTCGATTCTAGCCTCTATTAATTTTATCACAACTATTATTAATATAAAACCACCCGCCATTTCCCAATATCAAACACCACTTTTTGTTTGATCTATCCTTGTAACTACTGTCCTCCTCCTCCTAGCCCTTCCCGTCCTTGCAGCCGCAATTACAATATTATTAACTGACCGTAATTTAAACACAACGTTTTTTGATCCCGCAGGAGGAGGAGACCCCATCCTCTATCAACACTTATTTTTATCTTCGGTCACCCGGGAAAGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oxynotus centrina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bcd+4bd

Version
3.1

Year Assessed
2007

Assessor/s
Bradaï, M.N., Serena, F. & Bianchi, I. (Mediterranean) and Ebert, D.A. (South Africa)

Reviewer/s
Dulvy, N.K., Cavanagh, R.D., Valenti, S.V. & Soldo, A. (Shark Red List Authority)

Contributor/s

Justification
A medium-sized (to 150 cm but mostly <100 cm) deepwater, bottom dwelling shark distributed throughout the Eastern Atlantic and Mediterranean and possibly off Mozambique at known depths of 60 to 660 m. Taken primarily as bycatch by offshore bottom and pelagic trawlers in the Mediterranean Sea and the Northeast Atlantic. Survey data for the Mediterranean indicate that the species is now rare in the western (Morocco, Spain and France) and eastern (Aegean) areas and absent from the eastern central area (Adriatic, Ionian and Albania). However, records in the Adriatic and Ionian, suggest that the species still exists there in unknown numbers. In another survey, the species was also absent in the Gulf of Lions where it once occurred, indicating that it may be locally extinct in that region. The large spiny dorsal fins and relatively large body size make this species particularly vulnerable to capture in nets and its depth distribution lies entirely within the depth of fisheries throughout much of its range. The mortality of discards is likely to be high given the depths of capture. The current extremely low level of abundance throughout much of this species former range, and evidence for local scale declines, suggests an assessment of Critically Endangered in the Mediterranean. Off southern Africa, O. centrina is only known from a few specimens. It may occasionally be caught as bycatch in trawl fisheries there, but at present it is not possible to assess this species beyond Data Deficient in this region. Data are lacking on population trends in the Northeast Atlantic, however, given the high fishing pressure throughout much of its range in the Northeast Atlantic, the growing trend in deep sea fishing, the vulnerable life-history characteristics, and susceptibility to capture, there is no reason to suspect that it has not also declined in this region. Based on the species unproductive life history characteristics and documented declines in the Mediterranean as well as inferred declines in the Northeast Atlantic, and continuing fishing pressure through much of its range, the species is assessed as Vulnerable globally, on the basis of suspected and documented past and future declines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Relatively wide ranging. Rare in some parts (e.g., Angola, Atlantic coast of South Africa) and uncommon in others (northern Namibia, Mediterranean Sea) (Compagno in prep).

Mediterranean
Catch data for O. centrina in the Mediterranean exists for the period from 1994 to 1999 (at depths from 10 to 800 m) as part of the Mediterranean International Trawl Survey (MEDITS). During this period, O. centrina was recorded in only 0.6% of tows, with the majority of catches made at between 100 to 200 m depth (STECF 2004). Regional biomass indexes indicate that the species is more common in the western central Mediterranean (Tyrrhenian, Corsica, Sardinia, Sicily) with a lower biomass index in the western (Morocco, Spain and France) and eastern (Aegean) Mediterranean areas. During these surveys, it was found to be absent from the Eastern central Mediterranean (Adriatic, Ionian and Albania) (STECF 2004).

Trawl surveys in 1948 indicated that the species was once present, though uncommon (0.21 % of hauls, 0.25% of surveys, estimated density of 1.15 kg km-2) in the Adriatic and the absence of the species in subsequent MEDITS surveys suggests that it may be locally extinct from the area (Dulvy et al. 2003). However, there have been recent records of juveniles caught in the central Adriatic (Lipej et al. 2004, A. Soldo pers. comm). Also, data collected during other (DESEAS) surveys of the Balearic Sea and Ionian Sea found one specimen in the western Ionian Sea at 800 m (Sion et al. 2004). Apparently then, O. centrina still exists in the Eastern central Mediterranean in unknown numbers.

Between 1957 and 1960 O. centrina was captured in approximately 6% of hauls (n=27) in shelf surveys (coast to 150 m) and in approximately 6% of hauls (n=37) in slope surveys (150 to 800 m) in the Gulf of Lions, France (Aldebert 1997). Although it persisted in catches at low abundance up to 1992, it was subsequently absent in 139 hauls made during a trawl survey spanning 1994 to 1995 (Aldebert 1997), suggesting that the species is locally extinct from this area (Dulvy et al. 2003). MEDITS data for the period from 1994 to 1999 found lower abundances in the west than in other areas of the Mediterranean, although the species was present (STECF 2004).

Northeast Atlantic
This species was absent in a recent and intensive study of the deepwater longline fishery for sharks off the Canary Islands, where it was previously present (Hernandez et al. 1997). There is no information on the abundance of this species elsewhere in the region.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Primarily caught in the Mediterranean Sea and the Northeast Atlantic as a minor bycatch by large offshore bottom and pelagic trawl fleets (Compagno in prep). Mediterranean Benthic trawl effort has increased in both intensity and efficiency in the shelf and slope area of the Mediterranean over the last 50 years. For example, the Gulf of Lions area was initially exploited by small-scale benthic trawl fisheries, comprising 27 small low powered boats (total nominal horse power of 2,700 hp), and more recently effort has increased to a total nominal horse power of 19,940 hp (1974 to 1987). Since then half of the fishing effort has been displaced to targeting small pelagic fish (Aldebert 1997). The Adriatic Sea is subject to trawling mainly by Italian, Croatian, Slovenian, and Albanian fleets, however, no landings data are available (Jukic-Peladic et al. 2001). In the southern Mediterranean and off the Tunisian coasts this species is fished at depths of 60 to 100 m, where it reproduces (Bradaï et al. 2002). It is considered rare in Tunisian waters and is taken as bycatch with no economic value (M.N. Bradaï pers. obs). Most size classes are likely to be taken in fishing nets as the legal mesh size used in much of the Mediterranean is approximately 20 mm. Considering the large size at maturity (around 60 cm total body length), the exploitation of juveniles and probability of capture before breeding is likely to be high. The depth range of this species (60 to 660 m) lies entirely within the range of deepwater fisheries in the Mediterranean. Therefore it will not be protected by the ban on bottom trawling below depths of 1,000 m in the Mediterranean, adopted by the General Fisheries Commission for the Mediterranean (GFCM) in February 2005. According to Dulvy et al. (2003) the large spiny dorsal fins and relatively large body size, may make this species vulnerable to fishing exploitation, however Serena (pers. obs.) has commented that the species is of no commercial value in the Mediterranean and is usually discarded immediately because fishermen in the region believe that it brings bad luck. Discards have sometimes been observed alive (Serena pers. obs.), however, there are no data on the post release survival of the species and mortality is likely to be high given the depth at capture.

It is widely acknowledged that there has been a fairly rapid increase in deepwater fishing activities in the Northeast Atlantic with overall concern for the sustainability of deepwater fish stocks (Gordon et al. 2003). Oxynotus centrina is known from depths which are entirely within the range of several longline, trawl and gillnet fisheries operating throughout the Northeast Atlantic distribution of the species. The species has already been shown to be vulnerable to being taken as bycatch in the Mediterranean and is also likely to be subject to bycatch pressure in the Northeast Atlantic. There is a continuing trend of increasing deepwater fishing activities in the Northeast Atlantic, while regulation is often lagging. Deepwater sharks are potentially at risk from these activities although little species-specific information is available. Oxynotus centrina may also be caught occasionally as bycatch in trawl fisheries off South Africa but there are insufficient data to support this and the taxonomy of specimens caught there remains uncertain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bcd+4bd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There is an urgent need for the monitoring of landings and bycatch of this species and the collection of distribution and life history data in order to better understand the population structure and trends. The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: reliable: based on ex-vessel price for this species
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Angular roughshark

The angular roughshark, Oxynotus centrina, is a rough shark of the family Oxynotidae.[1]

Taxonomy[edit]

Biologist Carl Linnaeus founded the Angular Roughshark, O. centrina, in 1758. This name was later finalized and accepted by the scientific community as the official name for the species in 1976.[2]

Description and Feeding[edit]

At birth they are less than 25 cm (10 in) and they mature at about 50 cm (20 in). Most records are of individuals less than 1 m (3.28 ft), but they can reach up to about 1.5 m (4.9 ft). Their litter size is from 7-8 pups off Angola to 23 in the Mediterranean. They have ridges over their eyes that expand into large rounded knobs, which are covered with enlarged denticles – these are absent in other species of rough shark. They possess very large spiracles that are vertically elongated, being almost as high as the length of their eye. Their first dorsal spine is orientated slightly forward. They feed on worms, crustaceans, and mollusks.[3]

O. centrina has a compressed body, triangular in cross section, with a broad and flattened head. The snout is flat and blunt. Just like all of the Oxynotus species, they have two relatively large dorsal fins that are sail-like and no anal fin. Their color scheme is grey or grey-brown dorsally with dark blotched on its head and sides. However, one identifying feature is the light horizontal line below the eyes on the cheek.[4]

Since it shares the northeast Atlantic with another species of Oxynotus, another distinguishing feature, mentioned above, are the extremely large spiracles, their dorsal fins, and their large dermal denticles above their eyes. Although, like most of the Oxynotus species, O. centrina has lanceolate upper teeth and blade-like lower teeth, with 12 rows of teeth on either side.[4]

O. centrina usually moves by gliding on the bottom of the sea, sometimes hovering over the sandy or muddy surfaces of the seabed.[5]

Range and habitat[edit]

They occur in the eastern Atlantic from Norway to South Africa, including the entire Mediterranean. They may also occur off Mozambique. They prefer coralline algal and muddy bottoms on continental shelves and upper slopes at depths of 50 to 660 m (165 to 2165 ft), but occur mostly below 100 m (328 ft).[3]

Reproduction[edit]

Male and female angular roughsharks are reported to mature ate about 50–70 cm. Although, some studies have shown that females mature at a slightly larger size than males. Being an ovoviviparous species, O. centrina produce 10-12 pups usually between the sizes of 21 and 24 cm in length.[4]

Population[edit]

Some data has been gathered on this species of Oxynotus in the period from 1994 to 1999 in the Mediterranean. O. centrina was only present in 0.6% of the tows during this period at a depth of 100 to 200 m. Regional indexes indicate this species is more common in the western central Mediterranean and lower index in the western and eastern Mediterranean. However, O. centrina was completely absent from the Eastern central Mediterranean.[2]

In 1948, trawl surveys indicated that O. centrina was once present, but uncommon, in the Adriatic. Although, the species has been absent in subsequent studies in the Adriatic, suggesting a possible extinction of that species in the area. However, recent studies, done by Lipej in 2004, show that some juveniles have been caught in the central Adriatic. Also, some data collected during the surveys in the Balearic Sea and the Ionian Sea found one specimen at 800 m in the western Ionian Sea, suggesting that the population of O. centrina, in the Eastern central Mediterranean, has an unknown population.[2]

However, this species was absent in the Northeast Atlantic in a study of deepwater longline fishing for sharks near the Canary Islands. This is important because this species was abundant in this region until 1997.[2]

Threat and Conservation[edit]

O. centrina in a minor bycatch of offshore fisheries such as trawl fleets. Although this can have a negative impact on the species, as stated above, the species has been extinct in Adriatic for some time, but due to decreased fisheries in the Adriatic, the species seems to be refurbished[disambiguation needed].[2]

This species, sometimes caught by fisherman in the Mediterranean, has little to no commercial value. Also, it is thought to bring bad luck to fisherman if caught and kept. Although, released, it has never been reported of this fish to survive.[2]

The IUCN Red List of Threatened Species has deemed this species of Oxynotus as vulnerable due to consistent landings by fisherman and bycatch by deepsea fisheries. The implementation of management plans is to require conserving and sustaining management of all chondrichthyes species in the region.[2]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Oxynotus centrina" in FishBase. July 2006 version.
  2. ^ a b c d e f g "Oxynotus centrina." (Angular Rough Shark). N.p., n.d. Web. 1 Dec. 2013. <http://www.iucnredlist.org/details/63141/0>.
  3. ^ a b Compagno, L., Dando, M. and Fowler, S. Sharks of the World. Princeton Field Guides ISBN 0-691-12072-2
  4. ^ a b c Hurst, Richard. "Factsheet: Angular Roughshark." Factsheet: Angular Roughshark. N.p., n.d. Web. 30 Nov. 2013. <http://www.sharktrust.org/shared/factsheets/angular_roughshark_st_factsheet.pdf>.
  5. ^ "Angular rough shark (Oxynotus centrina)." Angular rough shark videos, photos and facts. N.p., n.d. Web. 1 Dec. 2013. <http://www.arkive.org/angular-rough-shark/oxynotus-centrina/>.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!