Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Usually found in outer reef slopes and frequently in the deeper surge channels or adjacent ledges. Form small groups in sub-tidal habitats (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: East Africa to the Indo-Malayan Archipelago and Vanuatu, north to Taiwan, south to northern Australia, New Guinea, and the Solomon Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 11 - 12; Analspines: 2; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 60 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Usually found in outer reef slopes and frequently in the deeper surge channels or adjacent ledges.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distinguished from similar species by the all-yellow anal fin (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Neopomacentrus azysron
Catalog Number: USNM 95680
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Catanduanes Island, Cabugao Bay (east); East coast of Luzon, San Bernardino Strait to San Miguel Bay, Catanduanes, Philippines, Philippine Archipelago, Cabugao Bay, Pacific
Depth (m): 3 to 5
Vessel: Albatross
  • Holotype: Fowler, H. W. & Bean, B. A. 1928. Bulletin of the United States National Museum. No. 100: 182.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Neopomacentrus azysron
Catalog Number: USNM 95678
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Catanduanes Island, Cabugao Bay (east); East coast of Luzon, San Bernardino Strait to San Miguel Bay, Catanduanes, Philippines, Philippine Archipelago, Cabugao Bay, Pacific
Depth (m): 3 to 5
Vessel: Albatross
  • Paratype: Fowler, H. W. & Bean, B. A. 1928. Bulletin of the United States National Museum. No. 100: 182.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Neopomacentrus azysron
Catalog Number: USNM 95679
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1908
Locality: Lianga Bay (Mindanao, P.I.), Mindanao, Philippines, Pacific
Vessel: Albatross
  • Paratype: Fowler, H. W. & Bean, B. A. 1928. Bulletin of the United States National Museum. No. 100: 182.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 12 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 39 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 1 - 40
  Temperature range (°C): 24.608 - 29.264
  Nitrate (umol/L): 0.019 - 0.565
  Salinity (PPS): 32.200 - 35.547
  Oxygen (ml/l): 4.346 - 4.851
  Phosphate (umol/l): 0.120 - 0.350
  Silicate (umol/l): 0.897 - 5.231

Graphical representation

Depth range (m): 1 - 40

Temperature range (°C): 24.608 - 29.264

Nitrate (umol/L): 0.019 - 0.565

Salinity (PPS): 32.200 - 35.547

Oxygen (ml/l): 4.346 - 4.851

Phosphate (umol/l): 0.120 - 0.350

Silicate (umol/l): 0.897 - 5.231
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Usually found in outer reef slopes and frequently in the deeper surge channels or adjacent ledges (Ref. 7247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neopomacentrus azysron

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTTCTTATTCGAGCAGAACTAAGTCAACCAGGCGCACTCTTAGGAGACGACCAAATTTATAATGTCATTGTAACTGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTGATTGGTGGCTTCGGGAACTGATTAATCCCACTCATGCTAGGCGCCCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCCCCATCATTCCTTCTCCTACTTGCCTCCTCCGGAGTCGAGGCAGGGGCCGGAACAGGCTGAACTGTTTACCCCCCTCTATCTGGGAACCTGGCCCACGCAGGGGCTTCAGTAGACCTAACCATCTTCTCCCTTCACCTGGCCGGTATTTCATCCATCCTGGGGGCAATTAACTTTATTACCACCATCATTAACATAAAACCCCCTGTTATATCTCAATATCAAACTCCACTATTTGTCTGAGCCGTCTTAATTACTGCGGTCCTCCTTCTCCTGTCACTCCCCGTACTAGCTGCTGGTATCACTATGCTTCTTACAGACCGAAATCTAAACACCACATTCTTTGACCCAGCTGGTGGGGGAGATCCAATTTTATACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neopomacentrus azysron

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Neopomacentrus azysron

Neopomacentrus azysron is a Damselfish from the Indo-West Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 7.5cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!