Overview

Comprehensive Description

Biology

Have been trawled on the continental shelf and slope; juveniles recorded from surface waters (Ref. 9563). Depth range reported at 0m-600m in Ref. 5449.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southeast Atlantic: Tristan de Cunha and South Africa. Western Indian Ocean: South Africa. South Pacific: southern Australia and New Zealand and Cape Horn, Chile. North Pacific records refers to pectoralis (Ref. 4537).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern circumglobal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14 - 15; Dorsal soft rays (total): 8 - 10; Anal spines: 4 - 5; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 560 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

56.0 cm TL (male/unsexed; (Ref. 5449))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head and body bluish above, pale below.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 0 - 1000 m (Ref. 75886)
  • López-Abellán, L.J., M.T.G. Santanaría and J.F. González 2008 Approach to ageing and growth back-calculation based on the otolith of the southern boarfish Pseudopentaceros richardsoni (Smith, 1844) from the south-west Indian Ocean seamounts. Mar. Freshw. Res. 59:269-278. (Ref. 75886)   http://www.fishbase.org/references/FBRefSummary.php?id=75886&speccode=3611 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 76 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.

Environmental ranges
  Depth range (m): 17.5 - 80000
  Temperature range (°C): 1.502 - 14.581
  Nitrate (umol/L): 7.983 - 35.179
  Salinity (PPS): 34.337 - 34.913
  Oxygen (ml/l): 3.960 - 6.027
  Phosphate (umol/l): 0.699 - 2.489
  Silicate (umol/l): 3.842 - 135.212

Graphical representation

Depth range (m): 17.5 - 80000

Temperature range (°C): 1.502 - 14.581

Nitrate (umol/L): 7.983 - 35.179

Salinity (PPS): 34.337 - 34.913

Oxygen (ml/l): 3.960 - 6.027

Phosphate (umol/l): 0.699 - 2.489

Silicate (umol/l): 3.842 - 135.212
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 600m.
Recorded at 600 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental slope (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudopentaceros richardsoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCTTAAGCCTGCTCATTCGGGCAGAACTAAGTCAACCAGGCGCCCTTTTAGGGGACGACCAAATTTACAACGTAATCGTTACAGCGCATGCATTTGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGAAATTGACTTATTCCCCTGATGATCGGGGCTCCAGACATAGCATTCCCTCGAATGAATAATATGAGTTTTTGGCTTCTGCCCCCATCTTTTCTCCTCCTCCTTGCTTCCTCTGGGGTAGAAGCTGGTGCCGGCACCGGATGAACAGTCTATCCTCCCCTGGCTGGTAACTTAGCCCACGCAGGAGCATCTGTTGATCTAACAATTTTCTCTCTGCACTTAGCGGGCATTTCCTCAATCCTTGGGGCCATTAATTTCATTACAACCATCATTAACATAAAACCTCCCGCTATTTCCCAATATCAGACTCCCCTCTTTGTATGAGCTGTATTAATTACTGCCGTCCTCCTCCTTCTCTCCCTTCCAGTTCTCGCTGCCGGTATCACAATGCTTCTCACAGATCGAAACCTTAACACCACCTTCTTTGACCCTGCGGGAGGAGGGGACCCAATCCTCTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudopentaceros richardsoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pelagic armorhead

The pelagic armorhead, pelagic armourhead, Richardson's boarfish, or southern boarfish, Pseudopentaceros richardsoni, is an armorhead of the genus Pseudopentaceros, found in the north and south Pacific Ocean, South Africa, South America, and the South Island of New Zealand, from the surface to depths of 300 metres on the continental shelf. Its length is between 30 and 50 cm.

As food

Because its spawning grounds were confined to a few seamounts in the central North Pacific, the pelagic armorhead was easily overfished. Soviet and Japanese trawlers took approximately 900,000 tons beginning in 1969; by 1984, the pelagic armorhead had been fished to commercial extinction. It has never been widely eaten in Europe or the United States.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!