Overview

Comprehensive Description

Biology

Inhabit clear lagoon and seaward reefs to at least 25 meters (Ref. 5503). Solitary or in small groups (Ref. 9710). Adults usually in pairs, but sometimes seen in small aggregations (Ref. 48637). Mimic the poisonous puffer, Canthigaster valentini which it greatly resembles. Feed on eggs, gastropods and grazes the substrate (Ref. 5503, 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Chagos, Kenya, Mauritius, Mozambique, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa south to Aliwal Shoal, South Africa (Ref. 4421) and east to Fiji, north to southern Japan, south to the southern Great Barrier Reef and New Caledonia. Recently recorded from Tonga (Ref. 53797). Replaced by Paraluteres arquat in the Red Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 25 - 28; Analspines: 0; Analsoft rays: 22 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 4421))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits clear lagoon and seaward reefs at depths of 2 to at least 25 m. Mimics the poisonous puffer, @Canthigaster valentini@ which it greatly resembles. Feeds on eggs, gastropods and grazes the substrate (Ref. 5503).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ranges from pale greenish to dirty white in color; blackish-brown saddles above; normally with a round dark blotch above origin of anal fin; soft dorsal and anal fins hyaline, tips dusky; caudal fin yellowish (Ref. 4421).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 20 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 1.14375 - 37
  Temperature range (°C): 25.709 - 28.954
  Nitrate (umol/L): 0.050 - 0.622
  Salinity (PPS): 33.950 - 35.312
  Oxygen (ml/l): 4.446 - 4.802
  Phosphate (umol/l): 0.055 - 0.167
  Silicate (umol/l): 0.910 - 3.344

Graphical representation

Depth range (m): 1.14375 - 37

Temperature range (°C): 25.709 - 28.954

Nitrate (umol/L): 0.050 - 0.622

Salinity (PPS): 33.950 - 35.312

Oxygen (ml/l): 4.446 - 4.802

Phosphate (umol/l): 0.055 - 0.167

Silicate (umol/l): 0.910 - 3.344
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 25m.
From 1 to 25 meters.

Habitat: reef-associated. Blacksaddle mimic.  (Bleeker, 1851) Attains 11 cm. Ground colour varies from pale greenish to a dirty white; prominent blackish-brown saddles on dorsal surface, the middle extending down sides of body towards ventral surface; usually a round dark blotch above origin of A. Soft D and A hyaline (transparent), tips of rays dusky; C yellowish. Tropical Indo-West Pacific; south to Aliwal Shoal, Natal, South Africa. This species closely resembles the poisonous black-saddled toby, Canthigaster valentini, with which it is usually associated. Paraluteres indicus ms - Western Indian Ocean form - Africa to Maldives Paraluteres andamensis ms - West coast of Thailand and Myanmar, probably also in Andaman Islands - one individual photographed at Bali Paraluteres arqat - Red Sea endemic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits clear lagoon and seaward reefs to at least 25 m. Feeds on eggs, gastropods and grazes the substrate (Ref. 5503).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 1 specimen with morphological vouchers housed at State Herbarium of South Australia
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Paraluteres prionurus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6316-09|NC_011929|Paraluteres prionurus| ACCCGTTGACTCTTTTCAACCAATCACAAAGACATCGGCACCCTTTACATGATCTTCGGTGCTTGAGCTGGAATAGTAGGCACTGCTTTG---AGCCTCCTGATTCGAGCAGAACTAAGCCAGCCCGGCGCCCTTCTTGGGGAC---GACCAGATTTATAATGTAATCGTAACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGAAACTGACTCATTCCTCTAATA---ATCGGTGCCCCTGATATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTCCTACCCCCCTCTTTCCTACTCCTCCTTGCATCTTCAGGGGTTGAAGCCGGTGCCGGCACCGGGTGGACTGTTTACCCCCCTCTTGCAGGCAACCTTGCCCACGCAGGAGCCTCCGTTGACTTA---ACAATCTTCTCCCTTCACCTGGCAGGTATCTCCTCTATTCTAGGAGCAATTAATTTTATTACAACTATTATTAACATGAAACCTCCAGCTATTTCCCAATATCAAACACCCCTGTTTGTCTGAGCAGTCCTAATCACCGCTGTCTTACTCCTCCTGTCCCTTCCAGTCCTTGCTGCA---GGAATTACTATACTTCTCACCGACCGAAATTTAAACACTACTTTCTTCGACCCGGCAGGAGGGGGGGACCCAATCCTATATCAACATTTGTTCTGATTCTTTGGCCACCCCGAAGTATACATTTTAATTCTACCCGGATTTGGAATAATTTCCCACATCGTAGCTTACTACTCAGGTAAAAAA---GAACCCTTTGGCTACATAGGAATAGTTTGAGCAATAATGGCAATCGGCCTACTTGGCTTTATCGTCTGAGCCCACCATATGTTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paraluteres prionurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 12
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blacksaddle filefish

The blacksaddle filefish, Paraluteres prionurus, is a filefish of the family Monacanthidae. It reaches a length of a maximum 11 cm.

The blacksaddle filefish are found in pairs or in small schools and inhabit reefs across the Indian and Pacific oceans.

Coloration is sandy to grey with distinctive black "saddles" on the back and a yellow tail.

The blacksaddle filefish has evolved to mimic Canthigaster valentini, a highly poisonous pufferfish commonly found where ever P. prionurus is found. The two species have been known to school together.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!