Overview

Brief Summary

The largemouth bass (Micropterus salmoides) is freshwater fish in the sunfish family (Centrarchidae). The largest of the seven species in genus Micropterus (which are all popular game fish known as the black basses), M. salmoides grows to a length up to 29.5 inches (the record), about 25 pounds, and lives 16 years. Although native to the great lakes region of North America, the largemouth bass’ enormous sporting appeal precipitated the introduction of the largemouth bass to stock waterways around the world. A highly adaptable and aggressive fish, it has had a devastating impact upon native species in many countries, prompting the Global Invasive Species Database to declare largemouth bass one of the 100 worst invading species. The largemouth bass is the state fish of Alabama (official freshwater fish), Georgia, Mississippi, Florida (state freshwater fish), and Tennessee (official sport fish).

( IUCN/SSC 2006; Michigan Department of Natural Resources, 2011; Wikipedia 13 January 2012; Wikipedia 3 January 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits clear, vegetated lakes, ponds, swamps, and backwaters and pools of creeks and rivers (Ref. 5723). Usually found over mud or sand and common in impoundments (Ref. 5723). An introduced species in Europe reported to avoid fast-flowing waters and to occur in estuaries with a salinity up to 13 ppt (Ref. 59043). Prefers quiet, clear water and over-grown banks. Adults feed on fishes, crayfish and frogs; young feed on crustaceans, insects and small fishes. Sometimes cannibalistic. Does not feed during spawning; as well as when the water temperature is below 5°C and above 37°C (Ref. 30578). Popular game fish in North America. Preyed upon by herons, bitterns, and kingfishers (Ref. 1998). Excellent food fish (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species is native to the St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins from southern Quebec to Minnesota and south to Texas, the Gulf Coast, and southern Florida, including Atlantic drainages from North Carolina to Florida and Gulf drainages from southern Florida to northern Mexico (Page and Burr 1991). It has been introduced throughout the United States, southern Canada, and much of world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is native to the St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins from southern Quebec to Minnesota and south to Texas, the Gulf Coast, and southern Florida, including Atlantic drainages from North Carolina to Florida and Gulf drainages from southern Florida to northern Mexico (Page and Burr 1991). It has been introduced throughout the United States, southern Canada, and much of world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Micropterus_salmoides is native to eastern North America and historically ranged from southern Canada to northern Mexico, and from the Atlantic coast to the central region of the United States. Since the beginning of the twentieth century largemouth bass have been introduced successfully all over the world.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced )

Other Geographic Terms: cosmopolitan

  • Hubbs, C. 1964. Fishes of the Great Lakes Region. Ann Arbor, MI: University of Michigan Press.
  • Carlander, K. 1977. Handbook of Freshwater Fishery Biology. Ames: Iowa State University Press.
  • Page, L., B. Burr. 1991. A Field Guide to Freshwater Fishes. Boston, Mass: Houghton Mifflin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: St. Lawrence - Great Lakes, Hudson Bay (Red River), and Mississippi River basins; Atlantic drainages from North Carolina to Florida and to northern Mexico. The species has been introduced widely as a game fish and is now cosmopolitan. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Micropterus salmoides is native to eastern North America and historically ranged from southern Canada to northern Mexico, and from the Atlantic coast to the central region of the United States. Since the beginning of the twentieth century largemouth bass have been introduced successfully all over the world.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced )

Other Geographic Terms: cosmopolitan

  • Hubbs, C. 1964. Fishes of the Great Lakes Region. Ann Arbor, MI: University of Michigan Press.
  • Carlander, K. 1977. Handbook of Freshwater Fishery Biology. Ames: Iowa State University Press.
  • Page, L., B. Burr. 1991. A Field Guide to Freshwater Fishes. Boston, Mass: Houghton Mifflin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern half of North America, introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Micropterus_salmoides has a large mouth, a notch between the two dorsal fins, and a dark stripe along the side of the body (Bailey et al., 2004). This black band is seemingly made up of small oval shapes to a closer eye. Coloration is variable, but is usually a darkish green on the back and sides, fading to an off-white on the belly. The anterior dorsal fin has nine to eleven spines while the posterior dorsal fin has twelve to fourteen rays (Boschung et al., 2004). The average weight of M._salmoides is one kilogram; however, certain individuals have reached weights of over ten kilograms. Males usually do not surpass 40 cm, while females can reach up to 56 cm in length.

Range mass: 10 (high) kg.

Average mass: .9 kg.

Range length: 56 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Bailey, R., W. Latta, G. Smith. 2004. An Atlas of Michigan Fishes. Ann Arbor, MI: Miscellaneous Publications.
  • Boschung, H., R. Mayden, J. Tomelleri. 2004. Fishes of Alabama. Mobile, Al: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 10; Dorsal soft rays (total): 11 - 14; Analspines: 3; Analsoft rays: 10 - 12; Vertebrae: 30 - 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Micropterus salmoides has a large mouth, a notch between the two dorsal fins, and a dark stripe along the side of the body (Bailey et al., 2004). This black band is seemingly made up of small oval shapes to a closer eye. Coloration is variable, but is usually a darkish green on the back and sides, fading to an off-white on the belly. The anterior dorsal fin has nine to eleven spines while the posterior dorsal fin has twelve to fourteen rays (Boschung et al., 2004). The average weight of M. salmoides is one kilogram; however, certain individuals have reached weights of over ten kilograms. Males usually do not surpass 40 cm, while females can reach up to 56 cm in length.

Range mass: 10 (high) kg.

Average mass: .9 kg.

Range length: 56 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Bailey, R., W. Latta, G. Smith. 2004. An Atlas of Michigan Fishes. Ann Arbor, MI: Miscellaneous Publications.
  • Boschung, H., R. Mayden, J. Tomelleri. 2004. Fishes of Alabama. Mobile, Al: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 70 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 970 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

97.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 10.1 kg (Ref. 4699); max. reported age: 23 years (Ref. 46974)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Mouth large; maxillary extending beyond the eye. Pelvic fins not joined by a membrane. Green to olive dorsally, milk-white to yellow ventrally, with a black band running from the operculum to the base of the caudal fin. Caudal fin rounded. Caudal fin with 17 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Micropterus salmoides
Catalog Number: USNM 153574
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Newman
Locality: Ala.: Huntsville, Alabama, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Largemouth basses inhabit warm, quiet waters with low turbidity, soft bottoms, and beds of aquatic plants. Typical habitats include farm ponds, swamps, lakes, reservoirs, sloughs, creek pools, and river coves and backwaters. Many of the largest populations are in mesotrophic to eutrophic lakes or reservoirs. In lakes and reservoirs these fishes are usually close to shore. In general, they are in deeper water in winter than in summer.

Eggs are laid in shallow cleared depressions (nests) made by males in sand, gravel, or debris-littered bottoms, often at depths of 40-80 inches (1-2 meters) but up to at least 23 feet (7 meters) or as shallow as 8-12 inches (about 20-30 cm). Nests are often next to submerged objects and usually are more than 30 feet (9 meters) apart.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Largemouth Bass inhabit warm, quiet waters with low turbidity, soft bottoms, and beds of aquatic plants. Typical habitats include farm ponds, swamps, lakes, reservoirs, sloughs, creek pools, and river coves and backwaters. Many of the largest populations are in mesotrophic to eutrophic lakes or reservoirs. In lakes and reservoirs these fishes are usually close to shore. In general, they are in deeper water in winter than in summer.

Eggs are laid in shallow cleared depressions (nests) made by males in sand, gravel, or debris-littered bottoms, often at depths of 40-80 inches (1-2 metres) but up to at least 23 feet (7 metres) or as shallow as 8-12 inches (about 20-30 cm). Nests are often next to submerged objects and usually are more than 30 feet (9 metres) apart.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Largemouth bass prefer quiet, clear waters with abundant vegetation (Iguchi and Matsuura, 2004). More specifically, they prefer shallow water that is usually no deeper than 2.5 meters, but they sometimes occupy deeper regions. Abundant vegetation is important because it allows bass to hide from their prey and provides protection against predators. Their environment is also made up of regions of clear waters where the bass' vision can be utilized to detect prey.

Range depth: 0 to 3 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Iguchi, K., K. Matsuura. 2004. Predicting Invasions of North American Basses in Japan Using Native Range Data and a Genetic Algorithm. Transactions of the American Fisheries Society, 133: 845–854.
  • Hannon, D. 1996. Perfect Bass Water. Outdoor Life, 197 #5: 42.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 7.0 - 7.5; dH range: 10; depth range ? - 7 m (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Largemouth bass prefer quiet, clear waters with abundant vegetation (Iguchi and Matsuura, 2004). More specifically, they prefer shallow water that is usually no deeper than 2.5 meters, but they sometimes occupy deeper regions. Abundant vegetation is important because it allows bass to hide from their prey and provides protection against predators. Their environment is also made up of regions of clear waters where the bass' vision can be utilized to detect prey.

Range depth: 0 to 3 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Iguchi, K., K. Matsuura. 2004. Predicting Invasions of North American Basses in Japan Using Native Range Data and a Genetic Algorithm. Transactions of the American Fisheries Society, 133: 845–854.
  • Hannon, D. 1996. Perfect Bass Water. Outdoor Life, 197 #5: 42.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 87 specimens in 3 taxa.

Environmental ranges
  Depth range (m): 0.1 - 10

Graphical representation

Depth range (m): 0.1 - 10
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 7m.
Recorded at 7 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Fry feed mainly on zooplankton. Larger young eat insects, crustaceans, and fish fry. Adults eat mainly fishes, though sometimes prefer crayfish or amphibians (Moyle 1976, Smith 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Immature Micropterus_salmoides feed on zooplankton and aquatic insecta. As they grow their diet shifts to Astacoidea and other actinopterygii species. Lepomis are the food of choice for most adult largemouth bass.

Animal Foods: fish; insects; aquatic crustaceans; zooplankton

  • Olsen, M., B. Young. 2003. Patterns of Diet and Growth in Co-occurring Populations of Largemouth Bass and Smallmouth Bass. Transactions of the American Fisheries Society, 132: 1207-1213.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabit streams and lakes (Ref. 10294). Survive in the cool areas of some highland dams where they were introduced as sporting fish (Ref. 4967). Introduced in Europe since 1883. Prefer warm waters of 27°C (Ref. 11273) and occur in small shallow lakes (maximum depth of 6 m) or in shallow bays of big lakes. Rarely found in big rivers (Ref. 11243). Juveniles feed mainly on invertebrates, plankton and insect larvae (Ref. 10294, 11243); individuals from 5 cm TL become almost exclusively piscivores but also feed on frogs and some crustaceans. These are dusk and dawn feeders, feeding in schools chasing their prey near the surface and in zones with vegetation. Feeding slows down in winter and during spawning (Ref. 11243). Preyed upon by herons, bitterns, and kingfishers (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Immature Micropterus salmoides feed on zooplankton and aquatic insects. As they grow their diet shifts to crayfish and other fish species. Sunfish are the food of choice for most adult largemouth bass.

Animal Foods: fish; insects; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore )

  • Olsen, M., B. Young. 2003. Patterns of Diet and Growth in Co-occurring Populations of Largemouth Bass and Smallmouth Bass. Transactions of the American Fisheries Society, 132: 1207-1213.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Micropterus_salmoides plays an important role in the ecosystem as a top predator. Top predators are important because they maintain the populations of all of the animals below them in the food chain. Their success is not limited by any specific type of prey. Instead, they prey upon a number of species, and therefore maintain the health and viability of the ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Larval and juvenile largemouth bass are prey species of perca flavescens, Stizostedion vitreum, esox lucius, and esox masquinongy. As adults, largemouth bass can usually escape most predators. The primary predators on adult largemouth bass are homo sapiens.

Known Predators:

  • yellow perch (Perca_flavescens)
  • walleye (Stizostedion_vitreum)
  • northern pike (Esox_lucius)
  • muskellunge (Esox_masquinongy)
  • humans (Homo_sapiens)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Micropterus salmoides plays an important role in the ecosystem as a top predator. Top predators are important because they maintain the populations of all of the animals below them in the food chain. Their success is not limited by any specific type of prey. Instead, they prey upon a number of species, and therefore maintain the health and viability of the ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Larval and juvenile largemouth bass are prey species of yellow perch, walleye, northern pike, and muskellunge. As adults, largemouth bass can usually escape most predators. The primary predators on adult largemouth bass are humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Micropterus salmoides (Trophic species 20) is prey of:
Hirundinidae
Perca flavescens
Micropterus salmoides
Ambloplites rupestris
Pomoxis nigromaculatus
Diacyclops thomasi
Mesocyclops edax

Based on studies in:
USA: Wisconsin, Little Rock Lake (Lake or pond)
USA: Michigan, Tuesday Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • Jonsson et al. 2005. Food webs, body size, and species abundance in ecological community description. Advances in Ecological Research 36:1-78.
  • Martinez ND (1991) Artifacts or attributes? Effects of resolution on the Little Rock Lake food web. Ecol Monogr 61:367–392
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Micropterus salmoides (Trophic species 20) preys on:
Sphaeromais
Bezzia
Diaptomus minutus
Diacyclops thomasi
Mesocyclops edax
Tropocyclops prasinus
Epischura lacustris
Bosmina longirostris
Eubosmina
Daphnia galeata mendotae
Daphnia parvula
Diaphanosoma birgei
Holopedium gibberum
Leptodora kindtii
Polyphemus pediculus
Conochilus unicornis
Conochiloides
Kellicottia longispina
Kellicottia bostoniensis
Keratella cochlearis
Keratella taurocephala
Keratella crassa
Keratella hiemalis
Polyarthra remata
Polyarthra vulgaris
Trichocerca cylindrica
Asplanchna
Gastropus
Synchaeta
Copepoda
Monogonanta
Chydorus
Gerris
Leptophlebia
Caenis
Oecetis
Mystacides
Limnephilus
Agrypnia
Banksiola
Molanna
Polycentropus
Enallagma
Vellidae
Notonectidae
Sialis
Eoparagyractis
Chaoborus punctipennis
Albabesmyia
Clinotanypus
Djalmabatista
Guttipelopia
Larsia
Macropelopis
Procladius
Chaetocladius
Corynoneura
Cricotopus
Nanocladius
Micropsectra
Paratanytarsus
Chironomus
Cladopelma
Cryptochironomus
Endochrionomus
Glyptotendipes
Microtendipes
Parachironomus
Paratendipes
Polypedilum
Pseudochironomus
Stenochironomus
Stictochironomus
Xenochironomus
Campeloma decisum
Sphaeriidae
Oligochaeta
Hirundinidae
Tricladida
Crangonyx gracilis
Perca flavescens
Micropterus salmoides
Ambloplites rupestris
Pomoxis nigromaculatus
Notemigonus crysoleucus
Anisoptera
Libellula
Sympetrum
Cyprinus carpio
Pimephales notatus
Lepomis macrochirus
Stizostedion vitreum
Chelydra serpentina
Anas fulvigula
Amazilia tzacatl
Alligator mississippiensis
Daphnia pulex

Based on studies in:
USA: Wisconsin, Little Rock Lake (Lake or pond)
USA: Michigan, Tuesday Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • Jonsson et al. 2005. Food webs, body size, and species abundance in ecological community description. Advances in Ecological Research 36:1-78.
  • Martinez ND (1991) Artifacts or attributes? Effects of resolution on the Little Rock Lake food web. Ecol Monogr 61:367–392
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Rhabdochona Infestation 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Largemouth Bass Iridovirus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goezia Disease 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eye Infection (Diplostomum sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Contracaecum Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Acolpenteron Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Achtheres Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

May have small summer range or may wander widely (Moyle 1976). Young have strong schooling tendency (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Largemouth bass perceive their environment through visual, auditory, tactile, and chemical means, as do most fish.

Perception Channels: visual ; acoustic

  • von der Emde, G., J. Mogdans, B. Kapoor. 2004. The senses of fish : adaptations for the reception of natural stimuli. Boston: Kluwer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Largemouth bass perceive their environment through visual, auditory, tactile, and chemical means, as do most fish.

Perception Channels: visual ; acoustic

  • von der Emde, G., J. Mogdans, B. Kapoor. 2004. The senses of fish : adaptations for the reception of natural stimuli. Boston: Kluwer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Largemouth basses may be active throughout most of the daylight hours and usually are relatively inactive at night and in winter; feeding is most intence near dawn and dusk in the warmer months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

After hatching, which usually takes from three to four days, larvae form a school that moves with the close protection of a male adult. Once the individuals reach a length of almost three centimeters they leave the school to fend for themselves. At this point, the juveniles are approximately one month in age. From this point on their growth rate occurs at different speeds throughout their lives. During the first year, largemouth bass grow from 10 to 20 centimeters in length. Growth rate decreases every year, and after about five to six years there is very little change in length.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The male which becomes aggressive and territorial builds the nest on muddy bottoms of shallow water. A female may spawn with several males on different nests. The male guards and fans the eggs. Spawning takes place spring to summer or when temperature reaches 15°C. Adults mate between the age of 5-12 years (Ref. 11243). Also Ref, 88808).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

After hatching, which usually takes from three to four days, larvae form a school that moves with the close protection of a male adult. Once the individuals reach a length of almost three centimeters they leave the school to fend for themselves. At this point, the juveniles are approximately one month in age. From this point on their growth rate occurs at different speeds throughout their lives. During the first year, largemouth bass grow from 10 to 20 centimeters in length. Growth rate decreases every year, and after about five to six years there is very little change in length.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Largemouth bass live much longer in the wild than they do in captivity. The longest known lifespan of a wild largemouth bass was 23 years. The expected lifespan in the wild, though, is around 15 years. In captivity the longest lifespan recorded was 11 years, while the average age of death in captivity is around 6 years.

Range lifespan

Status: wild:
23 (high) years.

Range lifespan

Status: captivity:
11 (high) years.

Typical lifespan

Status: wild:
15 (high) years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: captivity:
6 years.

Average lifespan

Status: captivity:
11.0 years.

Average lifespan

Status: captivity:
11.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Largemouth bass live much longer in the wild than they do in captivity. The longest known lifespan of a wild largemouth bass was 23 years. The expected lifespan in the wild, though, is around 15 years. In captivity the longest lifespan recorded was 11 years, while the average age of death in captivity is around 6 years.

Range lifespan

Status: wild:
23 (high) years.

Range lifespan

Status: captivity:
11 (high) years.

Typical lifespan

Status: wild:
15 (high) years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: captivity:
6 years.

Average lifespan

Status: captivity:
11.0 years.

Average lifespan

Status: captivity:
11.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23 years (wild) Observations: Females appear to outlive males considerably (http://www.dlia.org/atbi/index.html).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning occurs mainly in spring or early summer after water temperatures have become sufficently warm. Spawning occurs mid-April to mid-June near the southern end of the range in Alabama, late April to early July near the northern range limit in Wisconsin. In Texas, spawning begins as early as February or as late as May, depending on water temperature. Eggs hatch in a few to several days, depending on water temperature. Males guard the eggs and hatchlings until the young bass disperse about a month after hatching. Individuals become sexually mature in 2-5 years, depending on growth rate, which increases with increasing temperature. See Moyle (1976), Becker (1983), and Scott and Crossman (1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the breeding season, each male prepares and builds a nest in shallow water. Nests are generally very crude in design. Once the nest is built a female swims near, and following an act of courtship, she lay her eggs in the nest.

Mating System: polyandrous

Micropterus_salmoides breeds in the spring. This time is determined by the temperature of the water, which usually ends up being around 60 degrees Fahrenheit. Females lay their eggs in the nests of males, and males then guard the eggs until they hatch. On average there are about 3,000 fry per nest, but as many as 6,000 have been observed (Becker, 1983). Following hatching, the schooling fry remain close to their father for at most one month (Dewoody et al., 2000). Largemouth bass females reach sexual maturity at four to five months of age, and males reach sexual maturity at three to four months of age.

Breeding interval: Largemouth bass breed once per year

Breeding season: Largemouth bass breed in the spring months (when water temperature reaches about 60 degrees Fahrenheit)

Range number of offspring: 6000 (high) .

Average number of offspring: 3000.

Range time to hatching: 3 to 4 days.

Average time to independence: 1 months.

Range age at sexual or reproductive maturity (female): 4 to 5 months.

Range age at sexual or reproductive maturity (male): 3 to 4 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Female largemouth bass do not invest anything more than their gametes to their offspring. Males begin their investment by constructing nests as well as defending these nests from intruders. Once the eggs hatch males remain with their broods and defend them against all predators. This continues usually for about a month.

Parental Investment: pre-fertilization (Protecting: Male); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Protecting: Male)

  • Dewoody, J., D. Fletcher, D. Wilkins, W. Nelson, J. Anise. 2000. Genetic Monogamy and Biparental Care in a Externally Fertilizing Fish, the Largemouth Bass. The Royal Society, 267: 2431-2437.
  • Cooke, S., R. Mckinley, D. Phillip. 2001. Physical activity and Behavior of a Centrarchid fish, Micropterus salmoides, during spawning. Ecology of Freshwater Fish, 10: 227-237.
  • Becker, G. 1983. Fishes of Wisconsin. Madison, Wisconsin: The University of Wisconsin Press. Accessed December 06, 2005 at http://www.seagrant.wisc.edu/greatlakesfish/becker.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the breeding season, each male prepares and builds a nest in shallow water. Nests are generally very crude in design. Once the nest is built a female swims near, and following an act of courtship, she lay her eggs in the nest.

Mating System: polyandrous

Micropterus salmoides breeds in the spring. This time is determined by the temperature of the water, which usually ends up being around 60 degrees Fahrenheit. Females lay their eggs in the nests of males, and males then guard the eggs until they hatch. On average there are about 3,000 fry per nest, but as many as 6,000 have been observed (Becker, 1983). Following hatching, the schooling fry remain close to their father for at most one month (Dewoody et al., 2000). Largemouth bass females reach sexual maturity at four to five months of age, and males reach sexual maturity at three to four months of age.

Breeding interval: Largemouth bass breed once per year

Breeding season: Largemouth bass breed in the spring months (when water temperature reaches about 60 degrees Fahrenheit)

Range number of offspring: 6000 (high) .

Average number of offspring: 3000.

Range time to hatching: 3 to 4 days.

Average time to independence: 1 months.

Range age at sexual or reproductive maturity (female): 4 to 5 months.

Range age at sexual or reproductive maturity (male): 3 to 4 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Female largemouth bass do not invest anything more than their gametes to their offspring. Males begin their investment by constructing nests as well as defending these nests from intruders. Once the eggs hatch males remain with their broods and defend them against all predators. This continues usually for about a month.

Parental Investment: pre-fertilization (Protecting: Male); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Protecting: Male)

  • Dewoody, J., D. Fletcher, D. Wilkins, W. Nelson, J. Anise. 2000. Genetic Monogamy and Biparental Care in a Externally Fertilizing Fish, the Largemouth Bass. The Royal Society, 267: 2431-2437.
  • Cooke, S., R. Mckinley, D. Phillip. 2001. Physical activity and Behavior of a Centrarchid fish, Micropterus salmoides, during spawning. Ecology of Freshwater Fish, 10: 227-237.
  • Becker, G. 1983. Fishes of Wisconsin. Madison, Wisconsin: The University of Wisconsin Press. Accessed December 06, 2005 at http://www.seagrant.wisc.edu/greatlakesfish/becker.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Micropterus salmoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 90
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Micropterus salmoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCGACCAATCACAAAGATATCGGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTGAGTCTGCTAATTCGTGCAGAACTTAGCCAACCGGGCGCTCTTCTGGGAGAC---GACCAGATCTACAATGTAATTGTTACGGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGTTTTGGTAACTGACTTGTGCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCTCGAATAAACAACATAAGTTTTTGACTCCTTCCCCCTTCCTTCCTTCTCCTGCTCGCCTCTTCCGGTGTCGAAGCCGGGGCTGGCACTGGGTGGACTGTTTACCCCCCTCTTGCCGGCAACCTAGCCCATGCAGGAGCATCCGTCGACCTAACCATCTTCTCTCTTCACCTTGCTGGTGTCTCCTCTATTCTAGGGGCAATCAATTTTATTACCACAATTATTAATATAAAACCCCCAGCCATCTCCCAGTACCAAACACCCCTCTTTGTCTGATCCGTCCTAATTACTGCTGTCCTACTTCTTCTGTCACTTCCAGTCCTCGCTGCGGGCATTACAATGCTCCTTACAGACCGAAACCTCAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCCATTCTTTACCAGCACTTATTCTGGTTCTTTGGCCACCCAGAGGTTTATATTCTTATCCTCCCAGGGTTCGGGATGATTTCACATATTGTCGCCTACTACTCCGGGAAAAAGGAGCCTTTTGGTTACATGGGTATAGTTTGAGCCATGATAGCAATTGGCCTTTTAGGATTTATCGTCTGGGCCCATCACATATTTACTGTCGGAATGGATGTGGACACGCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely to be relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Micropterus_salmoides does not find itself on any of the lists of endangered species around the world. In fact the largemouth bass is one of the most successful fish, not only in its native areas, but also in freshwater areas all over the world where it has been introduced. There are certain fishing regulations that are set upon the catching of largemouth bass and these differ among regions. They involve either a limit to the number you can catch, a limit on the size that you can keep, or regulations on the season of the year in which you can catch them.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Micropterus salmoides does not find itself on any of the lists of endangered species around the world. In fact the largemouth bass is one of the most successful fish, not only in its native areas, but also in freshwater areas all over the world where it has been introduced. There are certain fishing regulations that are set upon the catching of largemouth bass and these differ among regions. They involve either a limit to the number you can catch, a limit on the size that you can keep, or regulations on the season of the year in which you can catch them.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely to be relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Extensively cultured in U.S. since 1930s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

With its many introductions all over the world, M._salmoides has had many negative impacts on the native ecosystems. Two of the main impacts are the loss of biodiversity and the homogenization of ecosystems. Introduced poplulations also influence the densities of other sport fishes like trout and walleye. These issues are currently being studied and management plans are being implemented all over the world.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Largemouth bass are important game fish. They are one of the most popular fishes to catch and they continue to bring popularity to the sport of fishing.

Positive Impacts: food ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

With its many introductions all over the world, M. salmoides has had many negative impacts on the native ecosystems. Two of the main impacts are the loss of biodiversity and the homogenization of ecosystems. Introduced poplulations also influence the densities of other sport fishes like trout and walleye. These issues are currently being studied and management plans are being implemented all over the world.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Largemouth bass are important game fish. They are one of the most popular fishes to catch and they continue to bring popularity to the sport of fishing.

Positive Impacts: food ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Largemouth bass

The largemouth bass (Micropterus salmoides) is a freshwater gamefish in the sunfish family, a species of black bass native to North America. It is also known by a variety of regional names, such as the brown bass, widemouth bass, bigmouth bass, black bass, bucketmouth, Potter's fish, Florida bass, Florida largemouth, green bass, green trout, gilsdorf bass, linesides, Oswego bass, southern largemouth and (paradoxically) northern largemouth; however, it is not a member of the bass family but actually a member of the Sunfish family.[3] The largemouth bass is the state fish of Alabama[4] (official freshwater fish), Georgia,[5] Mississippi,[6] Florida[7] (state freshwater fish), and Tennessee[8] (official sport fish).

Physical description[edit]

The largemouth is an olive green fish, marked by a series of dark, sometimes black, blotches forming a jagged horizontal stripe along each flank. The upper jaw (maxilla) of a largemouth bass extends beyond the rear margin of the orbit.[9] In comparison to age, a female bass is larger than a male.[10] The largemouth is the largest of the black basses, reaching a maximum recorded overall length of 29.5 in (75 cm)[11] and a maximum unofficial weight of 25 pounds 1 ounce (11.4 kg).[11] The fish lives 16 years on average.[12]

Forage[edit]

The juvenile largemouth bass consumes mostly small bait fish, scuds, small shrimp, and insects. Adults consume smaller fish (bluegill, banded killifish), snails, crawfish (crayfish), frogs, snakes, salamanders, bats and even small water birds, mammals, and baby alligators.[13] In larger lakes and reservoirs, adult bass occupy deeper water than younger fish, and shift to a diet consisting almost entirely of smaller fish like shad, yellow perch, ciscoes, shiners, and sunfish. It also consumes younger members of larger fish species, such as pike, catfish, trout, walleye, white bass, striped bass, and even smaller black bass. Prey items can be as large as 50% of the bass's body length or larger.

Studies of prey utilization by largemouths show that in weedy waters, bass grow more slowly due to difficulty in acquiring prey. Less weed cover allows bass to more easily find and catch prey, but this consists of more open-water baitfish. With little or no cover, bass can devastate the prey population and starve or be stunted. Fisheries managers must consider these factors when designing regulations for specific bodies of water. Under overhead cover, such as overhanging banks, brush, or submerged structure, such as weedbeds, points, humps, ridges, and drop-offs, the largemouth bass uses its senses of hearing, sight, vibration, and smell to attack and seize its prey. Adult largemouth are generally apex predators within their habitat, but they are preyed upon by many animals while young.[14]

Angling[edit]

Largemouth bass
Largemouth bass, caught and released in Minnesota
Main article: Bass fishing

Largemouth bass are keenly sought after by anglers and are noted for the excitement of their fight. The fish will often become airborne in their effort to throw the hook, but many say that their cousin species, the smallmouth bass, can beat them pound for pound.[15] Anglers most often fish for largemouth bass with lures such as plastic worms (and other plastic baits), jigs, crankbaits and spinnerbaits. A recent trend is the use of large swimbaits to target trophy bass that often forage on juvenile rainbow trout in California. Live bait, such as nightcrawlers, minnows, frogs, or crawfish can also be productive. In fact, large golden shiners are a popular live bait used to catch trophy bass, especially when they are sluggish in the heat of summer or in the cold of winter.[16] Largemouth bass usually hang around big patches of weeds and other shallow water cover. The world record largemouth according to IGFA is shared by Manabu Kurita and George W. Perry, Kurita's bass was caught from Lake Biwa in Japan on July 2, 2009 and weighed 10.12Kg (22lbs 4oz.) Perry's bass was caught June 2, 1932 from Montgomery Lake in Georgia and weighed 10.09Kg (22lbs 4oz.) This recorded is shared because the IGFA states a new record must beat the old record by 2 ounces. http://wrec.igfa.org/WRecordsList.aspx?lc=AllTackle&cn=Bass,%20largemouth The peak fishing times are spring and summer but large bass are caught all year long. Fly- fishing for Large Mouths can be exceptionally fun. It's best to fish over thick weed banks and shallow creeks in larger bodies of water. The best flies to use are streamers, wooly buggers, crawfish patterns, and even some bonefish flies such as the Bahama Mama. 6 and 7wt rods will cover any situation that you'll encounter.

Strong cultural pressure among largemouth bass anglers encourages the practice of catch and release, especially the larger specimens, mainly because larger specimens are usually breeding females that contribute heavily to future sport fishing stocks. Largemouth bass, if handled with care, respond well to catch and release. They have a white, slightly mushy meat, lower quality than that of the smallmouth bass, bluegill, yellow perch, crappie or walleye. Small largemouth, 10-14 inches, can be quite delicious when the water temperature is low but the large fish should be released.

Although it is most popular in the southeastern states, many varieties of the largemouth bass can be found in the north and western regions. They are an invasive species in the Canadian province of New Brunswick, and are a danger to native fish fry.[17]

Invasive species[edit]

The largemouth bass has been introduced into many other countries due to its popularity as a sport fish. It causes the decline, displacement or extinctions of species in its new habitat,[18] for example in Namibia.[19]

References[edit]

  1. ^ NatureServe (2013). "Micropterus salmoides". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 12 June 2014. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2010). "Micropterus salmoides" in FishBase. February 2010 version.
  3. ^ "Black Bass". Florida Fish and Wildlife Conservation Commission: Division of Freshwater Fisheries. Archived from the original on April 23, 2006. Retrieved March 17, 2007. 
  4. ^ "Official Alabama Freshwater Fish". Alabama Emblems, Symbols and Honors. Alabama Department of Archives & History. February 13, 2008. Retrieved May 9, 2007. [dead link]
  5. ^ "Georgia State Symbols". State of Georgia. Retrieved May 9, 2008. 
  6. ^ "State Symbols". State of Mississippi. Retrieved May 9, 2008. 
  7. ^ "State Freshwater Fish". State of Florida. Retrieved May 9, 2008. 
  8. ^ "State Symbols". State of Tennessee. Archived from the original on October 11, 2007. Retrieved May 9, 2008. 
  9. ^ In-Fisherman Largemouth Bass Description
  10. ^ Fresh water fish identification Largemouth bass.http://myfwc.com/wildlifehabitats/Freshwaterfish_LargemouthBass.htm. June 23, 2010
  11. ^ a b "Escondido's world-famous bass found dead". San Diego Union-Tribune. Retrieved May 27, 2009. 
  12. ^ "Largemouth Bass (Micropterus salmoides)". Texas Parks and Wildlife. Retrieved October 3, 2008. 
  13. ^ YouTube – Fish vs Alligator
  14. ^ In-Fisherman – Largemouth Bass Forage
  15. ^ Smallmouth Bass: Minnesota DNR
  16. ^ Retrieved 7/2013 - Bass Fishing Info About Bass, Bass Fishing and Bass Fishing Tips
  17. ^ New Brunswick Invasives
  18. ^ Leppakoski, Erkki. Invasive aquatic species of Europe: distribution, impacts, and management. Kluwer Academic Publishers. 1998. The Netherlands. 156-162.
  19. ^ "Micropterus salmoides". Invasive Species Specialist Group. April 11, 2006. Retrieved July 17, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Florida black bass

The Florida black bass or Black Bass is a type of largemouth bass, is a fish primarily found in Florida. It has a relatively wide roaming range, and can be found from the lowest points of the Great Lakes, the middle Mississippi River, and a majority of Southern States.[1]

History[edit]

Although the black bass is mainly found in Florida, other states have incorporated the fish into sport fishing lakes due to the species' particular hardiness and desirability.[2]

Mercury[edit]

Although it is a prized trophy fish, its consumption should be limited due to small amounts of mercury within the fish. Some experts suggest only six ounces per month so levels of mercury in the body do not reach dangerous levels.[2]

References[edit]

  1. ^ Unterman, Nathan A. "(Black) Largemouth bass". Newton. Retrieved 2009-08-15. 
  2. ^ a b "Florida's top Black Bass Spots". Florida "Fishing Capital of the World". 2006. Retrieved 2009-08-15. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Populations from different regions of U.S. are genetically distinct (Phillips et al. 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!