Overview

Comprehensive Description

Epibulus insidiator, the sling-jaw wrasse, is a spectacular coral reef fish that exhibits an extraordinary ability to protrude its jaws during feeding. This fish can rapidly protrude both upper and lower jaws to an extreme degree, extending the length of the head by 65% to capture evasive prey such as other fishes and small invertebrates. The sling-jaw is a member of the diverse and colorful fish family Labridae (the wrasses) and is closely related to the maori wrasses of the genus Cheilinus. The sling-jaw wrasse is among the most widely distributed coral reef fishes, occurring on coral reefs throughout the tropical Pacific from the Northwest Hawaiian Islands to the Western Pacific, Indian Ocean, and Red Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Inhabit coral-rich areas of lagoon and seaward reefs (Ref. 1602, 58302). Benthopelagic (Ref. 58302). Generally solitary (Ref. 5213). Feed on small coral-dwelling crustaceans and fishes (Ref. 9710). Capable of drift migration along with floating leaves (Ref. 27153). Adults usually along deep slopes or drop-offs. Sometimes they visit cleaning stations holding their mouth open and out for inspection (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to South Africa (Ref. 35918) and the Hawaiian and Tuamoto islands, north to southern Japan, south to New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Indo-Pacific and occurs from the Red Sea and East Africa to the Hawaiian and Tuamoto Islands, north to southern Japan, and south to New Caledonia.

Records from the main Hawaiian islands are based on single individuals recorded in O'ahu and Lanai and are considered waifs (Randall 2007). In this region, reproducing populations are known only in Johnston Atoll and the central part of the northwestern Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aldabra, Chagos, Djibouti, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Gambier Islands, north to southern Japan, south to Western Australia, Queensland (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

One of the most widespread of wrasses, this species inhabits coral reefs of the Red Sea, Indian Ocean, and the entire Western and Central Pacific region, reaching Hawaii and the Tuamotu Archipelago to the east.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 10; Dorsal soft rays (total): 9 - 11; Analspines: 3; Analsoft rays: 8 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 540 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

54.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epibulus insidiator diagnostic features

Diagnostic characters: Body moderately deep, maximum depth greater than length of head; dorsal profile of head convex in front of dorsal fin, a slight concavity above and before eye; head forming a broadly acute angle; jaws extremely protrusible, capable of being extended forward more then half the length of the head; 2 large canines situated anteriorly in each jaw; no enlarged tooth at rear of upper jaw; dorsal fin continuous, with 9 spines and 10 (rarely 11) soft rays, the spines and anterior soft rays of similar length; anal fin with 3 spines and 8 (rarely 9) soft rays; pectoral fins with 2 unbranched and 10 branched rays; pelvic fins filamentous in adults; caudal fin slightly rounded to truncate, the corners produced to form filamentous lobes in adults. Lateral line interrupted below posterior portion of dorsal fin, with a total of 22 or 23 pored scales. Scales reaching well onto bases of dorsal and anal fins; scales in front of dorsal fin extending forward to above eye; cheek and opercle scaled; lower jaw without scales.

Colour: overall brown or occasionally yellow; dorsal fin with several horizontal dark brown stripes and a black spot between first 2 spines; dark vertical bar on each scale; juveniles brown with several dark-edged, narrow, white bars and an ocellated black spot on anal fin and on rear of dorsal fin; large terminal phase males with whitish cheeks and nape, and reddish blotch of colour dorsally in front of dorsal fin origin.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The mouth of this species is protrusible and unfolds into a tube easily half the body length. The jaws swing forward into a long tube that strong suction to catch prey. When not in use, the entire apparatus is conveniently folded under the head. Small juveniles are brown with thin white bars and closely resemble a species of Wetmorella. Color varies with age and sex, but adult color varies additional, including with an all-yellow xanthic form. Sub adults and females are brown or, not uncommonly, uniformly yellow. Terminal males are dark with a white head and a dark streak extending horizontally through the eye. Male becomes ornamented with orange and yellow over the back. Juveniles dark with fine vertical white lines. Intermediates with yellow blotches, pale tail and sometimes with black pectoral fins (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits coral rich areas of lagoon and seaward reefs, from the lower surge zone to a depth of at least 40 m (Ref. 1602). Generally solitary (Ref. 5213). Feeds mainly on small fishes, crabs, and shrimps.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 42 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits lagoon and seaward reef down to 42 m (Lieske and Myers 1994). This species was suspected to be a protogynous hermaphrodite (Carlson et al. 2008).

Epibulus insidiator male colour was observed to intensify during courtship (Colin and Bell 1991). Males swam with caudal fin collapsed and tilted up and the anal fin folded and extended down. Males can revert to normal colour pattern when disturbed. The territory sizes of males were approximately 500-1,000 m2 and females seemed to have home ranges within this territory. Spawning occurred after or near high tide. It is sexually dimorphic with the size of male larger than the female. This species spawned in harem with males patrolling territory. Spawning ascent distance was about two to three m. Females were reported to lead the spawning. Spawning activities were found in March, April, May, July, September and October. The shape of the eggs is almost spherical.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 185 specimens in 1 taxon.
Water temperature and chemistry ranges based on 150 samples.

Environmental ranges
  Depth range (m): 0.61 - 1800
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.047 - 1.251
  Salinity (PPS): 32.019 - 36.148
  Oxygen (ml/l): 4.130 - 4.802
  Phosphate (umol/l): 0.055 - 0.415
  Silicate (umol/l): 0.910 - 5.501

Graphical representation

Depth range (m): 0.61 - 1800

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.047 - 1.251

Salinity (PPS): 32.019 - 36.148

Oxygen (ml/l): 4.130 - 4.802

Phosphate (umol/l): 0.055 - 0.415

Silicate (umol/l): 0.910 - 5.501
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 42m.
From 1 to 42 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat, biology and fisheries:

The sling-jaw is found on coral reefs of both exposed and protected areas to depths of 5-40m. It feeds upon small fishes, shrimps, and crabs which it can occasionally be seen capturing with its incredibly protrusive jaws. Large individuals are caught on hook and line, by spear, and are occasionally found in fish markets. The yellow phase is often captured for the aquarium trade, but fades to the more typical brown colour rendering it without commercial value.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits coral-rich areas of lagoon and seaward reefs (Ref. 1602). Generally solitary (Ref. 5213). Feeds on small coral-dwelling crustaceans and fishes (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Males have been observed patrolling their mating territory (see Ref. 27152).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Shooting snout snags prey: sling-jaw wrasse
 

The snout of the sling-jaw wrasse captures prey using multibar linkages to shoot its jaw out at high speed.

       
  "Nonetheless, the jaw mechanism of even a fancy snake looks simple next to what some fish do with multibar linkages in their heads (Westneat 1991). The most extreme must be the sling-jaw wrasse, Epibulus insidiator, which shoots out an otherwise unnoticeable snout to snag prey. According to Westneat and Wainwright (1989), who've analyzed the biomechanics of the system, this wrasse can protrude its jaw by a length equal to 65 percent of normal head length. Protrusion takes only about a thirtieth of a second; acceleration exceeds 100 meters per second squared, or 10 g; and snout speed hits 2.3 meters per second, or over 5 miles per hour. The components--bones, ligaments, and muscle--may be ordinary, but their arrangement is anything but." (Vogel 2003:401)

"Epibulus insidiator (Pallas) possesses the most extreme jaw protrusion ever measured in fishes. Biomechanical models of the mechanisms of jaw protrusion and hyoid depression in Epibulus are proposed and tested. The models are designed using principles of four-bar linkages from engineering theory. The models calculate the geometry of the feeding mechanisms from morphometric data on cranial anatomy. Predictions made from the models about the feeding kinematics of Epibulus are tested by comparison with kinematic data. The model of the jaw mechanism is accurate in predicting the unique feeding mechanics of the jaws of Epibulus for most relationships between kinematic variables. A model of simultaneous cranial elevation and sternohyoideus muscle contraction is accurate in predicting hyoid depression during feeding. Biomechanical considerations limit the number of possible pathways of evolution of the jaw mechanism of Epibulus from that of its closest labrid relatives." (Westneat 1991:159)

Watch video
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
  • Westneat, MW. 1991. Linkage biomechanics and evolution of the unique feeding mechanism of Epibulus insidiator (Labridae: Teleostei). Journal of Experimental Biology. 159: 165-184.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epibulus insidiator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTATTTGGTGCCTGGGCCGGAATAGTGGGCACTGCTCTGAGCCTACTCATTCGGGCAGAACTCAGCCAGCCGGGCGCTCTTCTCGGAGATGACCAGATCTATAATGTCATCGTCACGGCCCATGCCTTCGTTATAATCTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGGCTTATCCCACTTATGATCGGTGCCCCAGACATGGCCTTTCCTCGTATAAATAACATAAGCTTCTGACTTCTTCCTCCTTCCTTCCTTCTTCTCCTTGCCTCTTCTGGCGTAGAGGCAGGGGCCGGAACCGGATGAACAGTCTACCCCCCGCTGGCTGGAAACCTGGCCCACGCAGGTGCATCCGTAGACCTAACTATCTTTTCCCTCCACTTGGCCGGAATTTCATCTATTCTTGGTGCAATTAATTTTATCACAACTATTATTAACATAAAACCTCCAGCCATTACTCAGTACCAAACACCTTTATTTGTCTGGGCAGTTCTAATTACAGCAGTTCTGCTTCTACTATCACTTCCCGTCCTTGCTGCTGGCATCACAATGCTTCTAACGGACCGAAATCTAAACACCACATTCTTTGACCCGGCAGGAGGAGGAGACCCAATCCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Epibulus insidiator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
To, A., Liu, M., Craig, M. & Rocha, L.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and is common in many parts of its range. It is subjected to relatively small-scale fisheries, both as food fish and as ornamental fish. Catch data of this species is absent except for incomplete aquarium trade volume in several years. Although this species is unlikely to be seriously threatened at the current time, more information on the biology and harvest level of this species is needed for a more comprehensive status assessment. There are no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in many parts of its range.

This species was described as common in northwest Madagascar (McKenna and Allen 2005) and Enewetak Atoll, Marshall Islands (Colin and Bell 1991).

In Fiji, a total of 230 individuals were counted in various UVC surveys with body sizes of 4-30 cm TL (M. Kulbicki pers. comm. 2008).

In New Caledonia, a total of 524 individuals were counted in various UVC surveys with body sizes of 6-40 cm TL. In 15 stations, a total of 29 individuals were caught with total body weight of 2,127 g (M. Kulbicki pers. comm. 2008).

In French-Polynesia, a total of 210 individuals were counted in various UVC surveys with body sizes of 3-33 cm TL (M. Kulbicki pers. comm. 2008).

In Tonga, a total of 130 individuals were counted in various UVC surveys with body sizes of 6-35 cm TL (M. Kulbicki pers. comm. 2008).

On the east coast of Peninsular Malaysia, an estimated mean density of 4.3 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is collected for food fish fisheries, and was reported in the Hong Kong fish market (Situ andSadovy 2004). This species is also collected for the aquarium trade and such trade may have significant effect on fish natural population (Tissot and Hallacher 2003), however the level of use in ornamental fish or food trade is unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, this species distribution includes a number of Marine Protected Areas within its range. More species-specific information on harvest and trade for is needed for this species.


In Madagascar
This species was reported from the Natural Reserve of the Glorieuses Islands (Durville et al. 2003). Labrids are not major catches in the reef fishes surrounding the south-west Madagascar in 1997 (Laroche et al. 1997), and catch-per-unit-effort is still relatively high in these fishing grounds. There are two marine protected areas, with no-take zones, located in the northwest region of Madagascar (McKenna and Allen 2005). This species was commonly sighted during a rapid biodiversity survey in northwest Madagascar, and is likely protected within the protected areas (McKenna and Allen 2005).

In Mozambique
There is no known fishery management or regulations on this species in Mozambique. There is a 22 km2 marine reserve, two national parks and one wildlife sanctuary where coastal waters are protected (Francis et al. 2002, Wells et al. 2007). A fish survey in 2000 at various locations including marine protected areas did not record this species (Motta et al. 2002). The occurrence of this species within these areas needs further investigation.

In Australia
Queensland
Marine parks are established within Queensland including the well-know Great Barrier Reef. Marine parks are zoned for different purposes and offer different levels of protection from recreational and commercial fishing activities (Environmental Protection Agency 2008). For fishery management, a minimum size of 25 cm TL and a bag limit of 5 fish apply to all wrasses (Department of Primary Industries and Fisheries 2008a). There are three, nine-day closure to the taking of all coral reef fishes in Queensland east coast waters, which are in October, November and December each year around the new moon phase (Department of Primary Industries and Fisheries 2008b). There is no specific management measure or regulation on this species in commercial food fish fishery.

This species is collected as part of the international aquarium fish trade. Both recreational and licensed commercial aquarium fish collectors are allowed to operate within certain zones in the Great Barrier Reef (Ryan and Clarke 2005). While SCUBA and hookah are allowed for commercial collectors, recreational collectors can only use mask and snorkel for collecting aquarium fish. There are also gear restrictions (only by hands, small fishing lines or seine-nets) and bag limits (20 fish per person) on aquarium fish collection for both recreational and commercial collectors (Ryan and Clarke 2005). There is no specific management or regulation on E. insidiator.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Epibulus insidiator

The slingjaw wrasse, Epibulus insidiator, is a labrid best known for its remarkable degree of jaw protrusion.[3][4]

Notes

  1. ^ ITIS
  2. ^ BioLib
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2009). "Epibulus insidiator" in FishBase. July 2009 version.
  4. ^ Bone Q and Moore RH (2008) Biology of Fishes, Page 200. Taylor & Francis Group. ISBN 978-0-415-37562-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!