Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit lagoon and seaward reefs, usually in areas with mixed coral, sand, and rubble (Ref. 9710). Feed mainly on benthic, hard-shelled invertebrates, including mollusks, crustaceans and sea urchins (Ref. 5374). Young common on silty reefs, usually along edges with algae-rubble and sand (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species was formerly grouped with C. fasciatus. It is possible that both species occur in the Gulf of Aden.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is broadly distributed in the Indo-West-Pacific, and occurs from east Africa to Micronesia, Samoa and Marshall Islands, and north to the Ryukyu Island (Myers 1991, Parenti and Randall 2000, Westneat 2001) and south to the Great Barrier Reef, northwest Australia and New Caledonia (Myers 1991, Allen 2000).

Species of C.quinquecinctus are formerly lumped with this species. The true fasciatus does not occur in the Red Sea. Populations of C. fasciatus recorded from the Gulf of Aden, Socotoa and NE Somalia are probably quinquecinctus, but this needs to be researched.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to Micronesia and Samoa, north to the Ryukyu Islands (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Marshall Islands, Samoa and Tonga, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs on corals reefs and in sandy areas near reefs. Feeds mainly on benthic, hard-shelled invertebrates, including molluscs, crustaceans and sea urchins (Ref. 5374).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Small juveniles often mistaken for Wetmorella sp. Because of the thin vertical white barring. Large individuals develop bright red areas and males have extended caudal fin lobes (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Photographs taken in the Northern Red Sea as well as observations show that all individuals have a color pattern distinct from C. fasciatus. All large adults have a clearly different tail morphology: the entire outer margin is serrated or broom-like while it is smooth in fasciatus (Kuiter 2002).

Habitat of C. fasciatus might apply to this species. It inhabits relatively shallow coral reefs, to about 30 m depth. Members of this species, as in others of the genus, are solitary in habit and do not congregate in large numbers. It feeds mostly on hard-shelled prey, including molluscs, crustaceans and sea urchins (Fischer and Bianchi 1984).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in the coastal (Kuiter 2002, 2006), lagoon, seaward reefs, and usually in areas with mixed coral, sand and rubble (Lieske and Myers 1994, Allen 2000) at depths of four to at least 40 m (Myers 1991).

Juveniles of this species are often associated with the sea-grass beds and mangroves that adjacent to coral reefs (Dorenbosch et al. 2006), along edges with algae-rubble and sand, and silty reefs (Kuiter and Tonozuka 2001). Small juveniles are mistaken as adult of Wetmorella spp. or mis-identified as Epibulus spp. Due to their thin vertical white barring (Kuiter and Tonozuka 2001, Kuiter 2002).

The jaw is prominent, especially lower jaw in adults, two strong canines situated anteriorly in each jaw and there is no enlarged tooth present on rear or upper jaw of this species. Caudal fin rounded in juveniles, while the upper and lower rays forming extended cadual fin lobes in large individuals, a trilobed appearance. The lateral line of this species is interrupted below the posterior portion of dorsal-fin base with a total of 22 or 23 pored scales (Westneat 2001). It is distinguished by the bright red area at front of body (Allen 2000, Kuiter 2002) and thin orange to red lines radiating from eyes (Kuiter 2006). In large individuals, the six dark bars are usually broader than the six light ones (Westneat 2001).

It feeds primarily upon benthic small hard-shelled invertebrates, such as molluscs, crustaceans and sea urchin (Myers 1991, Westneat 2001) by possessing a strong oral jaw (Sale 2002).

In Marshall Islands, spawning was observed on the winward lagoon. It was found that spawning was not influenced by tidal currents. It spawned in harem with males patrolling territory. Patrolling males swam with the caudal fin folded and the dorsal and anal fin tips folded to points. Spawning activities lasted for almost three hours and concurred with similar activity by male Epibulus insidiator. Females ascended about one to three m over patch reef or coral head when ready to spawn with slow ascending speed (two to four sec. to go up with a length of 1.5 m). Spawning was observed only during afternoon and occurred at different tidal phases. Spawning activities were observed in May and October, while courtship was found in June and November (Colin and Bell 1991).

Further, the mean planktonic larval duration of this species was found to be 25.7 +/- 1.4 days (Victor 1986).

The maximum size is approximately 40 cm SL (Westneat 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 4 - 60 m (Ref. 9823), usually 4 - 40 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 207 specimens in 1 taxon.
Water temperature and chemistry ranges based on 178 samples.

Environmental ranges
  Depth range (m): 0.915 - 58
  Temperature range (°C): 25.819 - 29.336
  Nitrate (umol/L): 0.047 - 1.251
  Salinity (PPS): 32.276 - 35.347
  Oxygen (ml/l): 4.130 - 4.714
  Phosphate (umol/l): 0.057 - 0.380
  Silicate (umol/l): 0.567 - 6.058

Graphical representation

Depth range (m): 0.915 - 58

Temperature range (°C): 25.819 - 29.336

Nitrate (umol/L): 0.047 - 1.251

Salinity (PPS): 32.276 - 35.347

Oxygen (ml/l): 4.130 - 4.714

Phosphate (umol/l): 0.057 - 0.380

Silicate (umol/l): 0.567 - 6.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 60m.
From 4 to 60 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and seaward reefs, usually in areas with mixed coral, sand, and rubble. Feeds mainly on benthic, hard-shelled invertebrates, including mollusks, crustaceans and sea urchins.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cheilinus fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cheilinus fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATGGTGGGCACTGCTTTGAGCCTGCTCATTCGAGCAGAACTCAGCCAGCCAGGCGCTCTTCTTGGGGATGACCAGATCTACAACGTCATCGTCACGGCCCACGCTTTCGTTATGATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTCGGAAACTGGCTAATCCCCCTTATGATTGGNGCCCCCGACATAGCCTTTCCTCGTANAAATAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTACTTCTCCTTGCTTCTTCCGGGGTTGAAGCAGGGGCCGGCACCGGATGGACAGTCTACCCCCCGCTGGCTGGAAACTTAGCCCATGCAGGTGCATCTGTAGATTTAACAATCTTTTCCCTTCATCTAGCCGGAATTTCCTCTATTTTAGGGGCAATTAATTTTATTACAACTATCATTAATATGAAACCCCCCGCTATCACTCAATATCAGACACCCCTGTTCGTATGAGCGGTTCTAATTACAGCAGTTCTACTTCTTCTCTCCCTCCCCGTTCTCGCCGCCGGCATTACAATGCTTCTAACAGATCGAAACCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGAGACCCAATCCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R.F.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species was formerly grouped with C. fasciatus There is no population information available however, species is relatively abundant, there are no known threats, and it is present in a number of protected areas. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S. & Liu, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and is common in many parts of its range. There are no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. However, species was formerly grouped with C. fasciatus. Specimens need to be obtained for further genetic study.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in many parts of its range.

It is one of the most commonly observed target-species in the Louisiade Archipelago, Papua New Guinea. The percentage occurrence of C. fasciatus was 88% in the underwater census surveys of fifty-seven sites at the Louisiade Archipelago (Allen et al. 2000).

It is particularly common in areas of mixed coral and rubble of lagoon patch reefs in Micronesia (Myers 1991) and is also common reef fish in the Red Sea (Richard and Field 1998). In addition, it is common on lagoon and seaward reefs at Marshall Islands (Colin and Bell 1991).

Nakamura and Sano (2004) estimated the mean density of C. fasciatus in the Iriomote Island, Japan was 10 individuals per 500 m2.

In the Island of Zanzibar, east Africa, mean density of C. fasciatus was found to be 7.2 individuals per 500 m2 and the highest density of this species was found at Morogo with 24.5 fish per 500 m2 (Dorenbosch et al. 2006).

Despite the wide geographic range of this species, there is little quantitative information available on the local population status of this species. Further, the total numbers of C. fasciatus are not known.

In Fiji, a total of 230 individuals were counted in various UVC surveys with body length of 6-40 cm TL (M. Kulbicki pers. comm. 2008).

In Tonga, a total of 153 individuals were counted in various UVC surveys with body length of 6-35 cm TL (M. Kulbicki pers. comm. 2008).

On the east coast of Peninsular Malaysia, an estimated mean density of 2.6 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
There are no major threats known for this species. This species is caught for food and for the aquarium trade in some parts of its range.

Labrids are frequently captured by recreational and commercial fishers in Australia which are known to contribute to significant reductions in labrid densities (Gladstone 2001, Platten et al. 2002). Majority of the Cheilinus spp. captured by recreational fishers are reported as “wrasse/grouper” making the catch statistics under-representative of the real landings of C. fasciatus. In Gascoyne region, a 12 month survey indicated that 9,677 wrasse/groupers are captured by recreational fishers annually and in Shark Bay, western Australia, 10,082 individuals from wrasse/gropers were fishes annually (Summer et al. 2002). Meanwhile, on the west coast of western Australia, it was found that 65,000 individuals of various species from wrasse/groper were caught in recreational fishing (Summer and Williamson 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, this species distribution includes a number of Marine Protected Areas within its range. More species-specific information on harvest and trade for is needed for this species.

This species is found in the Curieuse Marine National Park, Seychelles (Pittman 1997), Mafia Island Marine Park, Tanzania (Garpe and Öhman 2003), Natural Reserve of Glorieuses Islands, Western Indian Ocean (Durville et al. 2003), Marine conservation area of Tuvalu (Kaly 1997), Fiji Marine Protected Area (Brown et al. 2007), the Shark Reef Marine Reserve (Brunnschweiler and Earle 2006) and the Great Barrier Reef Marine Park (Russell 2001).

In Queensland, the minimum legal size for wrasse is 25 cm and daily bag limit is fivr individual per species per angler, in addition, closed season for fishing applies to coral reef finfish (Queensland Government).

In Pilbara or Kimberley regions, Labridae is considered to have the highest risk of localised depletion and valued for eating qualities (Bray and Kennedy 1998, Government of Western Australia 2008). The minimum legal size for Labridae is 40 cm and the daily catch for Labridae is two per individuals per species per fisher, while the mixed daily bag limit is seven individuals per angler. Currently, management plans are being developed for the new Marine Conservation Parks which including no-take zones (Government of Western Australia 2008).

In Gascoyne region of Australia, there is no legal catch size for the Labridae and daily catch limit is seven individuals per angler. No spearfishing is allowed within the Ningaloo Marine Park (Government of Western Australia 2008a).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Redbreast wrasse

The red-breasted wrasse, Cheilinus fasciatus, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean.[2]

Description[edit]

This species can reach a maximum of 40 cm (16 in) in standard length.[2] Its head is greenish-blue, followed by a distinctive red-orange band followed by black and white stripes. Terminal phase fishes generally have a more pronounced red band and convex forehead than initial phase and juvenile fish.

Distribution[edit]

The red-breasted wrasse is native to the tropical waters of the Indo-Pacific region from the Red Sea and the African coast to the islands of the western Pacific.[2]

Habitat and diet[edit]

The red-breasted wrasse lives in lagoons and seaward reefs in areas mixing rubble, coral, and sand at depths of from 4 to 60 m (13 to 200 ft) though rarer below 40 m (130 ft).[2]

It feeds mainly on crustaceans, sea urchins, hard-shelled invertebrates, and mollusks.[3]


References[edit]

  1. ^ Shea, S. & Liu, M. 2010. Cheilinus fasciatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 11 September 2013.
  2. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2013). "Cheilinus fasciatus" in FishBase. August 2013 version.
  3. ^ http://eol.org/pages/223458/details#trophic_strategy
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!