Overview

Comprehensive Description

Biology

Is an omnivore with a tendency to feed on fish at the surface. The superior position of the mouth allows it to capture its prey while swimming from below. Also jumps out of the water to feed on large insects (Coleoptera; Ref. 27548). It is capable of adapting to environments with low oxygen levels (Ref. 12225).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Osteoglossum bicirrhosum are native to the Amazon drainage system, the western Orinoco and the Rupununi and Essequibo systems of the Guianas. When found in other locations it is because of introduction by man. For example, they have been introduced in secluded areas of California and Nevada. It is also thought that the fish have not distributed themselves further up river because they cannot pass through rapids successfully.

Biogeographic Regions: neotropical (Native )

  • Goulding, M. 1980. The Fishes and The Forest. Los Angeles: University of California Press.
  • Nico, L. July 18, 2000. "Nonindigenous Aquatic Species: Osteoglossum bicirrhosum" (On-line). Accessed October 19, 2000 at http://nas.er.usgs.gov/fishes/accounts/osteoglo/os_bicir.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to northern South America. Has been collected in California (probably aquarium releases) and Nevada (introduction by an ilegal fish farm), but not known to be established in the U.S. or Canada (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South America: Amazon River basin, Rupununi and Oyapock Rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Osteoglossum bicirrhosum are characterized by remarkable scale arrangements in which the scales are large, stout, bony and ornamented in a way that the radii form a course pattern. The scales are a pearly silver in color and change to reds, blues and greens as the fish ages. They are also well known for their bony tongue, after which it is named. Osteoglossum bicirrhosum are laterally compressed with a huge oblique mouth. Many oral bones bear teeth, including the jaw, palate, tongue and pharynx. They reach a maximum length of about 120 cm.

Average mass: 4600 g.

Range length: 120 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Average mass: 2530 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

90.0 cm TL (male/unsexed; (Ref. 50892)); max. published weight: 6,000 g (Ref. 72380)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body covered with very big scales; dorsal and anal fins almost fused with the caudal fin; 2 barbels at the extremity of the lower jaw; adult silvery, juvenile with blue glints and a yellow-orange bar (Ref. 12225).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Osteoglossum bicirrhosum live in both the white and black water floodplains of the Amazon as documented in a recent study of the fish communities. In both types of water they were most abundant in the flooded/swamp areas. Osteoglossum bicirrhosum are usually found in the shallower of these waters because of their predatory behavior.

Habitat Regions: tropical ; freshwater

Aquatic Biomes: rivers and streams

  • Saint-Paul, U., J. Zuanon, M. Villacorta, M. Garcia, F. Noemi. March 2000. Fish communities in central Amazonian white- and blackwater floodplains. Environmental Biology of Fishes, 57(3): 235-250.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Osteoglossum bicirrhosum are not picky eaters. In a study of their stomach contents, the majority of food items included insects and spiders, most of which were beetles. Also found in the stomachs were crabs, snails, fish, birds, snakes, monkey feces and plant material. It is thought that the snakes and monkey feces were consumed during a flooding. The plant material was probably a result of the predatory behavior of the fish, as explained below (Goulding 1980).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Is an omnivore with a tendency to feed on fish at the surface. The superior position of the mouth allows it to capture its prey while swimming from below. Also jumps out of the water to feed on large insects (Coleoptera; Ref. 27548). It is capable of adapting to environments with low oxygen levels (Ref. 12225).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Camallanus Infection 14. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

The male carries eggs, larvae and early juveniles (alevinos) in his mouth.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
6.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Osteoglossum bicirrhosum spawn at the beginning of the floods, December and January. The females produce a rather small number of large eggs. The males carry the eggs, larvae and early juveniles in their mouths until the yolk sac has been absorbed, which is about 2 months.

Breeding interval: These fish breed once a year.

Breeding season: Osteoglossum bicirrhosum spawn at the beginning of the floods, December and January

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

  • Goulding, M. 1980. The Fishes and The Forest. Los Angeles: University of California Press.
  • Froese, R. March 7, 2000. "Species Summary for Osteoglossum bicirrhosum" (On-line). Accessed October 25, 2000 at http://www.fishbase.org/Summary/SpeciesSummary.cfm?ID=6234.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 4 specimens with morphological vouchers housed at Florida Museum of Natural History and Raffles Museum, Singapore
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Osteoglossum bicirrhosum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1527-06|NC_003095|Osteoglossum bicirrhosum| ACTCGCTGATTTTTCTCAACCAACCACAAAGATATCGGAACCCTTTATTTAATCTTCGGAGCCTGGGCTGGAATAGTTGGCACCGCTCTT---AGCCTTCTGATTCGCGCAGAACTCAGCCAACCTGGATCCTTGCTTGGTGAT---GATCAAATTTATAATGTCATCGTCACAGCACATGCTTTTGTAATGATTTTCTTCATAGTAATACCAATTATAATCGGCGGATTTGGTAACTGACTTATTCCACTGATA---ATCGGTGCCCCAGACATAGCTTTCCCCCGAATAAACAATATGAGTTTTTGACTACTGCCGCCTTCATTCCTCCTTCTTTTAGCCTCATCTGGGGTAGAAGCTGGTGCAGGAACAGGATGAACTGTATACCCACCTTTAGCAGGAAACCTAGCACATGCAGGAGCATCCGTCGACTTA---ACTATCTTTTCACTACATCTGGCAGGTGTTTCATCTATTTTAGGGGCAATTAATTTTATTACTACAATCATCAATATGAAGCCCCCTGCCATCACTCAATACCAAACACCTCTGTTTATCTGATCCGTCCTAGTAACTGCAGTCCTTCTTCTCCTTTCTCTTCCAGTCTTAGCTGCA---GGTATTACAATACTTTTAACAGACCGTAACTTAAACACTACTTTCTTCGACCCAGCTGGGGGAGGGGACCCAATCCTATATCAACACTTATTCTGATTCTTCGGCCACCCTGAAGTATATATTTTAATCTTACCAGGGTTTGGAATAATCTCCCATATTGTAGCCTACTACTCTGGGAAAAAA---GAACCATTTGGTTATATAGGAATAGTCTGAGCTATGATAGCCATTGGACTATTGGGATTTATTGTATGAGCCCATCACATGTTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Osteoglossum bicirrhosum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Unknown

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Osteoglossum bicirrhosum are of great economic value to the local fisherman. According to Junk (1976) these fish provide the largest source of protein in comparison to other Amazon fish. Also, because of its low fat content, they are considered the most digestable and least likely to bring about sickness. Osteoglossum bicirrhosum are also of great value in the aquarium business, as noted by the sale of them on many commercial internet sites (Foeshe 2000, Smith 1981).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Silver arowana

The silver arowana, Osteoglossum bicirrhosum, sometimes spelled arawana, is a freshwater bony fish of the family Osteoglossidae, commonly kept in aquaria. The term "Osteoglossum" means "bone-tongued" and "bicirrhosum" means "two barbels" (from the Greek language).

Contents

Description

This species is found in the Amazon River basin and in the Rupununi and Oyapock Rivers in South America as well as in still waters in Guyana.

This fish has relatively large scales, a long body, and a tapered tail, with the dorsal and anal fins extending all the way to the small caudal fin, with which they are nearly fused. It can grow to a maximum size of 90 centimetres (35 in).[1] Unlike the Black arowana, Silver arowanas have the same coloring throughout their lifespan.

The species is also called monkey fish because of its ability to jump out of the water and capture its prey. It usually swims near the water surface waiting for potential prey. Although specimens have been found with the remains of birds, bats, and snakes in their stomachs, its main diet consists of crustaceans, insects, smaller fishes and other animals that float on the water surface, for which its draw-bridge-like mouth is exclusively adapted for feeding.

Arowana are sometimes called Dragon Fish by aquarists because their shiny armor-like scales and double barbels are reminiscent of descriptions of dragons in Asian folklore.

Conservation status

The Silver Arowana is currently not listed on any CITES appendix [2] nor on the 2004 IUCN Red List.[3] It is one of the most popular ornamental fish from South America, however, and therefore its conservation status merits attention.[4]

As reported by Environment News Service in August 2005, shared use of the Silver Arowana population was a cause for a dispute between Brazilian and Colombian authorities. Juvenile Silver Arowanas are caught in Colombia for sale as aquarium fish, while the people of Brazilian Amazonia catch adult fish for food. A sharp drop in the number of arowanas had caused Brazilian authorities to prohibit fishing of them between September 1 and November 15; the Colombians, on their part, would prohibit capturing them between November 1 and March 15. [5]

The Silver Arowana is often kept as a pet by experienced aquarist, being considered an accessible substitute for the Asian arowana, which is listed on CITES Appendix I and is therefore difficult and expensive to obtain legally.

Aquarium fish

Silver arowana are primarily surface dwellers.

Aquaria

To keep one of these large fish, a properly sized aquarium is important. The minimum recommendable tank size for one adult Silver Arowana is 300 gallons (8'X3'). At no time should an arowana be kept in a tank that is narrower and shorter than the length of the fish. A young specimen can be kept in a smaller tank, but as it grows a larger tank will be necessary to prevent deformities and to ensure the maximum length and life span of the animal.

Any aquarium housing an arowana should be tightly covered because of these fishes' jumping behavior. Also will jump out the water and attack the hands of people that are above the tank.

Water conditions

Silver Arowana prefer soft water with a pH level between 6.0 and neutral. Strong filtration is necessary for these large carnivores. Commercially available black water additives can help simulate the Silver Arowana's natural habitat, although they can adapt to most water supplies and thrive. A 25-30% water change, siphoning waste and other detritus, is necessary 1-2 times every week to maintain excellent water conditions. The water temperature should range from 24°C (75°F) to 28°C (82°F), with the ideal about 26°C (79°F).

A silver arowana variation known as "Snow arowana" or "Platinum arowana" caused by leucism (reduced pigmentation). From The 6th "Pramong Nomjai Thaituala" Thailand Tropical Fish Competition 2007.

Feeding

Silver Arowana may be offered meaty foods such as insects, shrimp, fish, frogs, pellet foods, etc., though it is best to feed the Arowana a brand of floating pellet food that has been specifically processed for fish of this type. There are several types of food on the market from some of the larger name brand makers of fish products that are made with this species in mind. Feeding the Arowana in this manner will help avoid dropeye, a condition in which one of the eyes are turned downward. In the wild, the Arowana spends most of its life scanning the water surface for prey, but it will learn in an aquarium environment to look downwards for food that sinks to the bottom of its tank. Over time, one eye will permanently droop downwards. However some Arowana fed exclusively on floating food pellets have also developed sudden dropeye after violently colliding with the tank. Another condition that can develop is "cloudy eye"; one or both of the eyes become scratched when the Arowana turns itself sideways to collect food from the bottom, causing them to cloud over. The cloudy eye condition is treatable, while the drop eye condition is not. Keeping an Arowana almost exclusively on a pellet diet will not only provide the fish with a well balanced meal, it is more cost effective and will generally prevent health issues. Many aquarists recommend against live feeder fish because these are often raised in poor conditions and are capable of transmitting diseases to predatory fish. Other risks include injury to the Arowana either while attempting to catch the feeder fish, or while swallowing. Mealworm exoskeletons are sometimes difficult for young Arowana to digest, so they are best avoided.

Tankmates

Silver Arowana can be kept with other freshwater fish as long as they are too large to fit in the arowana's mouth and can tolerate the arowanas active-swimming lifestyle. Many people like having more than one Arowana in the tank; in this case, hobbyists recommend keeping at least 5 to 6 in the tank at a time because Silver Arowana are very aggressive towards each other.

See also

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2006). "Osteoglossum bicirrhosum" in FishBase. 3 2006 version.
  2. ^ CITES Appendices
  3. ^ IUCN Red List
  4. ^ International meeting on ornamental fish boosts regional conservation and sustainable resource management initiatives (WWF)
  5. ^ Brazil, Colombia at Odds Over Silver Amazon Fish. A meeting between the representatives of the Amazon Basin countries in August 2005 was meant to discuss the dispute.

See also

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!