Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Perch is an extremely common freshwater fish. It has six to eight dark vertical stripes and two separate dorsal fins, the front one having hard spines. One finds fewer perch in ditches and small waters than in the IJsselmeer and other large waters and rivers. The average length of perch is between 20-35 centimeters. When the fish is small, it lives in schools and eats zooplankton. Fish between 10 and 15 centimeters eat invertebrates such as opossum shrimp and gammarids. Larger fish switch over to hunting their own kind or smelt. They avoid ruffe and roach as prey. Older perch live alone in deep water.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Perch live in schools, often mixing with other species of fish, usually in the top 50 metres of water. Spawning takes place in April, the very sticky eggs being produced in bands. Females twine these bands around submerged vegetation or among rocks while the males follow her and fertilise the eggs. The young fish hatch after about three weeks and remain amongst the egg bands until the yoke sac is exhausted. They then venture into more open water and feed on planktonic animals. As they grow they begin to shoal together close to the bank. Males mature when they reach the length of 7 – 8 cm, females when they are 10 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The perch is a distinctive fish, with a deep greenish body marked with dark vertical bands, and the dorsal fin is stiffened with spines. The tail and anal fins are orange and the gill-covers are tipped with a sharp spine. The erect dorsal fin has a noticeable black spot at the rear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits a very wide range of habitats from estuarine lagoons, lakes of all types to medium-sized streams. Feeding larvae occur in open water. This is an opportunistic diurnal feeder which preys mainly during sunrise and sunset, using all available prey. Larvae and small juveniles usually feed on planktonic invertebrates. During first summer, many juveniles move near shores to feed on benthic prey. Often feeds on fishes at about 12 cm SL. May undertake short spawning migrations. Males attain first sexual maturity at 1-2 years and females at 2-4 years of age. Spawns in February-July (Ref. 59043). Eggs grouped in long white ribbons (up to 1 m) are found over submerged objects (Ref. 41678). Its flesh is excellent and not so bony. Utilized fresh and frozen; eaten pan-fried and baked (Ref. 9988). May be captured with natural or artificial bait (Ref. 30578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Black Sea, IJsselmeer, New Zealand Exclusive Economic Zone, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eurasia: throughout Europe to northernmost extremity of Scandinavia, except Iberian Peninsula, central Italy, and Adriatic basin; Aegean Sea basin in Matriza and from Struma to Aliakmon drainages; Aral Sea basin; Siberia in rivers draining the Arctic Ocean eastward to Kolyma. Widely introduced. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Throughout Europe to northernmost extremity of Scandinavia, except Iberian Peninsula, central Italy and Adriatic basin; Aegean Sea basin: Maritza and from Struma to Aliakmon drainages; Aral Sea basin; in Siberia, in rivers draining to Arctic Ocean eastward to Kolyma (replaced by P. flavescens in North America). Introduced in Ebro delta (Spain), central and southern Italy, Lake Skadar (Montenegro, Albania), Amur (Siberia), Australia and South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Europe, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The perch is found over most of Europe, except in Spain, Italy or Greece. It is also found across northern Asia and Siberia as far as the Kolyma River. It has been introduced to a number of other countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The european perch is distribuited in many areas of europe. It lives in lakes and rivers with low current.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: fisher family fisher

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14 - 20; Dorsal soft rays (total): 13 - 16; Analspines: 2; Analsoft rays: 7 - 10; Vertebrae: 39 - 42
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 510 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm SL (male/unsexed; (Ref. 59043)); max. published weight: 4,750 g (Ref. 2058); max. reported age: 22 years (Ref. 796)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosed from other species of Percidae in Europe by having the following unique characters: pelvic and anal fins yellow to red; posterior part of first dorsal fin with dark blotch; and flank with 5-8 bold dark bars, usually Y-shaped. Differs further by the combination of the following features: two dorsal fins, clearly separated from each other; and 56-77 scales along lateral line (Ref. 59043). Body greenish-yellow; 5-9 transverse black bands on the sides; first dorsal fin gray, black spot at the tip; second dorsal greenish-yellow; pectorals yellow; other fins red. First dorsal fin markedly higher than the second. Caudal fin emarginate (Ref. 2058).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; pH range: 7.0 - 7.5; dH range: 8 - 12; depth range 1 - 30 m (Ref. 9988), usually 3 - 4 m (Ref. 55947)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
A very wide range of habitats from estuarine lagoons, lakes of all types to medium sized streams.

Biology:
Lives up to 21 years, usually to about six years. Males reproduce for the first time at 1-2 years, females at 2-4 years. Spawns in February-July, depending on latitude and altitude, when temperature reaches about 6°C. May undertake short spawning migrations. A female usually spawns with several males, once each year. The female circles the spawning site, followed by one male, while other males remain stationary. The egg strand is released as the female swims in spiral clockwise movements, folding herself into a U-shape. All eggs are released and fertilised within about 5 seconds in a single strand, which becomes twisted around and entangled with spawning substrate. Feeding larvae are positively phototactic, live in open water and feed on pelagic organisms. They may be widely distributed by currents. An opportunistic diurnal feeder, preying mainly at sunrise and sunset, using all available prey. Larvae and small juveniles usually prey on planktonic invertebrates. During first summer, many juveniles come near shores to feed on benthic prey. Often becomes piscivorous at about 120 mm SL. Stocks with different life-histories may co-occur in some lakes (littoral, benthic feeding, pelagic zooplanktivorous), sometimes with different spawning sites and times.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14374 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1161 samples.

Environmental ranges
  Depth range (m): 1 - 67
  Temperature range (°C): 4.258 - 7.898
  Nitrate (umol/L): 1.212 - 2.070
  Salinity (PPS): 5.681 - 9.183
  Oxygen (ml/l): 7.708 - 8.768
  Phosphate (umol/l): 0.114 - 0.389
  Silicate (umol/l): 10.213 - 14.880

Graphical representation

Depth range (m): 1 - 67

Temperature range (°C): 4.258 - 7.898

Nitrate (umol/L): 1.212 - 2.070

Salinity (PPS): 5.681 - 9.183

Oxygen (ml/l): 7.708 - 8.768

Phosphate (umol/l): 0.114 - 0.389

Silicate (umol/l): 10.213 - 14.880
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species prefers slow-moving rivers, deep lakes and ponds where it stays close to patches of vegetation and submerged objects. Perch require well-oxygenated water to survive.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Perca fluviatilis

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises skin of Perca fluviatilis

Animal / parasite / endoparasite
Camallanus lacustris endoparasitises intestine of Perca fluviatilis

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum gasterostei endoparasitises eye (humour) of Perca fluviatilis
Other: major host/prey

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Perca fluviatilis

Animal / parasite / endoparasite
fluke of Proteocephalus percae endoparasitises Perca fluviatilis

Animal / parasite / ectoparasite
colony of Trichodina ectoparasitises skin of Perca fluviatilis

Animal / parasite / endoparasite
Trypanosoma percae endoparasitises blood of Perca fluviatilis
Other: sole host/prey

Animal / parasite / endoparasite
metacaria of Tylodelphys clavata endoparasitises eye (humour) of Perca fluviatilis

Animal / parasite / endoparasite
metacaria of Tylodelphys podicipina endoparasitises eye (humour) of Perca fluviatilis

Animal / parasite / endoparasite
metacaria (diplostomula) of Tyrodelphys clavata endoparasitises vitreous humour of Perca fluviatilis

Animal / parasite / endoparasite
metacaria (diplostomula) of Tyrodelphys podicipina endoparasitises vitreous humour of Perca fluviatilis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Perca fluviatilis is prey of:
Esocidae
Perca

Based on studies in:
Finland (Lake or pond, Littoral)

This list may not be complete but is based on published studies.
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78:181-190, from p. 185.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • K. Aulio, K. Jumppanen, H. Molsa, J. Nevalainen, M. Rajasilta, I. Vuorinen, Litoraalin merkitys Pyhajarven kalatuotannolle, Sakylan Pyhajarven Tila Ja Biologinen Tuotanto (Lounais-Suomen Vesiensuojeluyhdistys R. Y., Turku, Finland, 1981) 47:173-176.
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78:181-190, from p. 185.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Perch Rhabdovirus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

During breeding, males arrive at the spawning area ahead of the females. One or two of these males chases a ripe female as soon as it arrives in the area (polyandry) (Ref. 6258). The queue of males maybe longer composed of about 15 to 25 individuals, but only two prod their snouts against the female's belly (Ref. 205). After rounds of curved course through the interlacing branches near the surface (Ref. 205), males fertilize the egg ribbon as the female lays them over weeds or other submerged objects (Ref. 6258). Eggs grouped in long white ribbons (up to 1 m) are found over submerged objects (Ref. 41678). Eggs hatch in about 8 to 16 days at normal temperatures (Ref. 6258).Males mature at 2-3 years and females at 4 years. Spawning, in the Northern hemisphere, happens in spring in waters with temperatures between 7-8°C. Eggs are laid in sticky strings becoming fixed toaquatic plants and rocks. Incubation lasts about 1- 8 days at 1- 3°. Egg size 2.0-2.5mm, larval length at hatching 5mm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 22 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Perca fluviatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACTGCCCTAAGCCTGCTCATCCGAGCAGAACTAAGCCAGCCCGGCGCTCTCCTTGGAGACGACCAGATTTATAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGGGGCTTTGGGAACTGACTAGTACCACTTATGATCGGTGCCCCTGATATAGCTTTCCCTCGAATAAATAACATGAGCTTTTGACTCCTACCCCCCTCTTTCCTTCTCCTTCTTGCTTCCTCAGGAGTCGAAGCTGGGGCTGGTACCGGGTGAACTGTATATCCACCTCTTGCTGGGAATTTAGCGCATGCTGGAGCATCTGTTGATTTAACCATTTTCTCCCTACACTTAGCGGGAGTTTCCTCAATTCTAGGTGCTATCAATTTTATTACAACAATCATTAACATAAAACCCCCTGCTATTTCCCAGTATCAAACCCCTCTATTCGTATGAGCTGTGCTAATTACCGCCGTTCTTCTCCTTCTCTCACTTCCTGTTCTTGCCGCTGGCATTACAATGCTTCTCACAGACCGAAACTTGAACACAACTTTCTTTGACCCTGCAGGAGGAGGCGACCCTATTCTTTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Perca fluviatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Specimens with Barcodes: 88
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Justification
A widespread species with no known major widespread threats.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Apart from pollution to their water bodies or rivers, perch do not appear to be a widely threatened species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In parts of its range, perch are a commercial fish, caught with seine and stake-nets. In the UK, it is mainly a sport fish, much prized for its fighting qualities when hooked. Perch may be caught throughout the coarse angling season (16 June – 14 March). In some of the countries where it has been introduced it is considered a pest species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European perch

Perca fluviatilis, commonly known as the European perch, perch, redfin perch or English perch, is a predatory species of perch found in Europe and Asia. The species is a popular quarry for anglers, and has been widely introduced beyond its native area, into Australia, New Zealand, and South Africa. They have caused substantial damage to native fish populations in Australia.

European perch are greenish with red pelvic, anal and caudal fins. They have five to nine dark vertical bars on their sides.

European perch can vary greatly in size between bodies of water. They can live for up to 22 years, and older perch are often much larger than average; the maximum recorded length is 60 cm (24 in). The British record is 2.8 kg (6 lb 2 oz), but they grow larger in mainland Europe than in Britain. As at Aug 2012, the official all tackle world record, as recognised by the International Game Fish Association stands at 2.9 kg (6 lb 6 oz) for a Finnish fish.[1] Due to the low salinity levels of the Baltic, especially around the Finnish archipelago and Bothnian Sea, many freshwater fish live and thrive there. Perch especially are in abundance and grow to a considerable size due to the diet of Baltic herring.

The perch spawns (in the Northern Hemisphere) at the end of April or beginning of May, depositing the eggs upon water plants, or the branches of trees or shrubs that have become immersed in the water; it does not come into condition again until July. The eggs have been known to stick to the legs of wading birds and then transferred to other waters where the birds visit.[citation needed]

Contents

Taxonomy [edit]

The first scientific description of the river perch was made by Peter Artedi in 1730. He defined the basic morphological signs of this species after studying perch from Swedish lakes. Artedi described its features, counting the fin rays scales and vertebrae of the typical perch.

In 1758, Carl Linnaeus named it Perca fluviatilis.[2] His description was based on Artedi's research.

Fishing [edit]

Baits for perch include minnows, goldfishs, weather loachs, or brandling, red, marsh, and lob worms, shrimps, and artificial lures. The tackle needed is fine but strong. Artificial lures are also effective, particularly for medium-sized perch.

Aquarium care [edit]

Keeping of perch requires a large tank and a suitable diet. The tank needs to be thickly planted with plants such as Elodea, Egeria, and others. Perch can be kept in ponds with other appropriate fish; as with most fish, larger ones may consume fry if they are available. A suitable diet is earthworm, flakes, silversides, and frozen foods such as blackworm. If fed properly, perch are less likely to feed on small fish. In the canal perch normally feed at the bottom of the current looking for any food worms/other smaller fish.

Relation to the yellow perch [edit]

Because of their similar appearance and ability to cross-breed, the yellow perch (Perca flavescens) has sometimes been classified as a subspecies of the European perch, in which case its trinomial name would be Perca fluviatilis flavescens.

See also [edit]

References [edit]

  1. ^ "Official World Record". 
  2. ^ "Synonyms of Perca fluviatilis Linnaeus, 1758". FishBase. Retrieved 2009-11-23. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!