Overview

Comprehensive Description

Biology

Occurs in outer reefs over bottom of coral rubble or heads of small finely branched coral. Feeds on zooplankton. Usually occurs in moderately large groups in depths of about 20-25 m (Ref. 48636).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known from the Philippines to southern Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: Philippines and Celebes, Indonesia.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Philippines and Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 9
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Variable in color from pinkish to bright red or purple and dorsal fin often bright yellow in adults (Ref. 48636).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Cirrhilabrus lubbocki Randall & Carpenter
Catalog Number: USNM 219365
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, J. Libbey, Bureau of Fisheries and Aquatic Resources (BFAR), Philippines & Silliman University Group
Year Collected: 1978
Locality: Philippine Is., Pamilacan I., Off SW Tip of Island., Philippines, Pacific
Depth (m): 33.5
  • Paratype: Randall, J. E. & Carpenter, K. E. 1980. Revue Francaise d'Aquariologie, Herpetologie. 7 (1): 18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Cirrhilabrus lubbocki Randall & Carpenter
Catalog Number: USNM 219336
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall & et al.
Year Collected: 1978
Locality: Philippine Islands; Luzon; Batangas; Caban Island SW Side, Luzon, Philippines, Pacific
Depth (m): 30 to 30
  • Paratype: Randall, J. E. & Carpenter, K. E. 1980. Revue Francaise d'Aquariologie, Herpetologie. 7 (1): 18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species usually occurs in moderately large groups commonly in depths of about 20-25 m. It occurs in a variety of habitats including coastal and inner reefs, and outer reefs over bottom of coral rubble or heads of small finely branched coral. It feeds on zooplankton, and occurs from 4-55 m depth.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 4 - 45 m (Ref. 9710), usually 5 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2.305 - 34
  Temperature range (°C): 28.015 - 28.310
  Nitrate (umol/L): 0.121 - 0.288
  Salinity (PPS): 33.532 - 34.325
  Oxygen (ml/l): 4.509 - 4.547
  Phosphate (umol/l): 0.091 - 0.222
  Silicate (umol/l): 1.491 - 2.199

Graphical representation

Depth range (m): 2.305 - 34

Temperature range (°C): 28.015 - 28.310

Nitrate (umol/L): 0.121 - 0.288

Salinity (PPS): 33.532 - 34.325

Oxygen (ml/l): 4.509 - 4.547

Phosphate (umol/l): 0.091 - 0.222

Silicate (umol/l): 1.491 - 2.199
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 45m.
From 4 to 45 meters.

Habitat: reef-associated. Occurs in outer reefs over bottom of coral rubble and/or heads of small finely branched coral. Feeds on zooplankton.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in outer reefs over bottom of coral rubble and/or heads of small finely branched coral. Feeds on zooplankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhilabrus lubbocki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCTTGAGCCGGAATAGTAGGCACAGCCTTAAGCCTACTAATTCGGGCAGAACTAAGCCAACCAGGGGCACTTCTTGGTGATGATCAGATTTATAATGTTATTGTAACTGCGCACGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATCGGGGGTTTTGGAAACTGACTTATTCCTCTAATAATTGGAGCTCCTGACATGGCATTCCCACGAATAAATAATATAAGCTTTTGGCTCCTTCCCCCATCCTTCCTCCTATTACTCGCATCTTCAGGTGTAGAAGCAGGGGCTGGCACAGGATGAACTGTTTATCCTCCATTAGCGGGCAACCTCGCACACGCAGGTGCATCAGTAGACTTAACCATCTTTTCTCTGCACCTTGCAGGCATTTCCTCCATCTTAGGCGCCATTAATTTTATTACTACTATTATTAATATGAAACCGCCTGCTATCTCCCAATATCAAACACCATTATTCGTTTGAGCCGTACTTATTACTGCTGTCCTCCTTCTTCTATCACTGCCCGTTTTAGCCGCTGGTATTACCATGCTCTTAACTGACCGAAATCTTAACACCACTTTCTTCGACCCCGCTGGAGGCGGTGACCCCATCCTTTATCAGCATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhilabrus lubbocki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L. & Hilomen, V.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is common in many parts of its range. Even though this species is commercialized in the aquarium trade, it is not commonly traded and does not reach a very high value. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is considered common throughout the Philippines, but can be uncommon in other parts of its range and in shallow waters.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species, although it is exploited in the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC) , IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known sepcies specific conservation measures in place for this species. This species range overlaps several marine protected areas within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cirrhilabrus lubbocki

Lubbock's wrasse, Cirrhilabrus lubbocki, is a species of wrasse native to coral reefs of the Philippines and the island of Sulawesi in Indonesia, though it also has been claimed to be present in Malaysia, Japan,[1] and Palau. It can be found at depths from 4 to 45 m (13 to 148 ft), though rarely deeper than 30 m (98 ft). This species can reach a total length of 8 cm (3.1 in). It can be found in the aquarium trade.[2]


References[edit]

  1. ^ a b Rocha, L. & Hilomen, V. 2010. Cirrhilabrus lubbocki. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 03 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cirrhilabrus lubbocki" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!