Overview

Comprehensive Description

Biology

More commonly found in shallow tidal areas with muddy bottoms and brackish waters, tolerating a wide range of salinities (virtually fresh to fully saline or hypersaline). Found only in spring and summer in the tidal portion of the Ochlockonee River, Florida. Feed mostly on Mysis and copepods, also small fishes, gastropods and isopods. Breed off North Carolina from late April to mid-July, perhaps through to August. Used to some extent to make anchovy paste (Ref. 189).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The bay anchovy, Anchoa mitchili, is a common and often extremely abundant fish of coastal and inshore waters of the western Atlantic. It is gray with a short head and a very short snout and a narrow silvery stripe about as wide as the pupil of the eye, running along the sides of the body. The dorsal fin is set far back on the body, just above or slightly in front of the insertion point for the anal fin. Ray counts are: dorsal = 14-16; anal = 24-30; pectoral = 11-12 (Hoese and Moore 1977, Robbins et al. 1986).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: from Casco Bay, Maine south to Florida Keys and westward around the Gulf of Mexico south to Yucatán
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This fish occurs along the western Atlantic and Gulf of Mexico coasts of North America, from Maine to Yucatán, Mexico (Page and Burr 2011).

Anchoa mitchilli is distributed in coastal waters in the western Atlantic from Casco Bay, Maine south to Florida Keys and westward around the Gulf of Mexico south to Yucatan (Accessed through Fish Base, www.fishbase.org, 26 July 2012). This species is a nearshore, coastal, and estuarine species. It seldom occurs in waters deeper than 25 m, but has been collected in 27-36 m depths (Houde and Zastrow).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) This fish occurs along the western Atlantic and Gulf of Mexico coasts of North America, from Maine to Yucatán, Mexico (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Casco Bay, Maine south to Florida Keys and westward around the Gulf of Mexico south to Yucatán; not in the West Indies.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay anchovies occur from the Gulf of Maine and Cape Cod, MA, south to Yucatan, Mexico, and throughout the Gulf of Mexico (Hoese and Moore 1977, Fives et al. 1986, Robbins et al. 1986). Bay anchovies occur throughout the India River Lagoon system.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 23 - 31
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm SL (male/unsexed; (Ref. 189))
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 10 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay anchovies typically grow to around 10 cm length (Robbins et al. 1986).Able et al. (2001) report Anchoa mitchilli populations are composed of multiple year-classes in Delaware Bay marsh creeks, suggesting a lifespan of more than one year.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body variable, more slender in northern populations. Snout fairly blunt, a little over 1/2 eye diameter; maxilla long, tip pointed, reaching beyond hind border of pre-operculum, almost to gill opening; panamensis-type gill cover canals. Anal fin rays rarely 28, its origin below unbranched dorsal fin rays. Anus nearer to pelvic fin tips than to anal fin origin.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Anchoa mitchilli
Catalog Number: USNM 127740
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Louisiana: Bastian Bag, Louisiana, United States, Gulf of Mexico, Atlantic
  • Paratype: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Anchoa mitchilli
Catalog Number: USNM 127735
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
  • Paratype: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Anchoa mitchilli
Catalog Number: USNM 127733
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
  • Paratype: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Anchoa mitchilli
Catalog Number: USNM 119790
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
  • Type: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Bay anchovies are similar in appearance to two other common Anchoaspecies with which it co-occurs throughout much of Florida. The striped anchovy (Anchoa hepsetus) often grows to be somewhat larger (to 15 cm) than the bay anchovy, and both it and the Cuban anchovy (A. cubana) have a dorsal fin that begins well in front of the anal fin. Bay anchovies are the only US anchovies in which the dorsal fin begins at a point right above or only very slightly in front of where the anal fin begins (Robbins et al. 1986).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat includes lower freshwater and estuarine reaches of coastal rivers, bays, sounds, and high salinity nearshore marine waters; usually it occurs in shallow waters, at depths of less than 20 meters.

Anchoa mitchilli is a pelagic species that occupies shallow coastal waters, estuaries, and lagoons. Is often more common in areas with muddy bottoms and brackish waters less than 25 m. This species tolerates a wide range of salinities (virtually fresh to full salinity or hypersaline conditions). It is a schooling species and schools tend to be located near the surface, but changes in depth distribution occurs seasonally and diurnally. Spawning takes place in the evening from late April to mid-July, perhaps through August off North Carolina, from May to November or February in water less than 20 m deep off Texas, and possibly year round off Biscayne Bay, Florida (Munroe and Nizinski 1999). A. mitchilli feeds on zooplankton, predominately copepods, also on gastropods, isopods, mysid shrimps, and small fishes. In areas where A. mitchilli is abundant it is extremely important in estuarine and coastal food webs because it links secondary plankton production to fisheries output(Munroe and Nizinski 2002). In the Chesapeake Bay this species may live to be slightly more than three years olds and adults may attain a maximum length of 110 mm (Houde and Zastrow).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes lower freshwater and estuarine reaches of coastal rivers, bays, sounds, and high salinity nearshore marine waters; usually it occurs in shallow waters, at depths of less than 20 meters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; amphidromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 36 m (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2294 specimens in 1 taxon.
Water temperature and chemistry ranges based on 567 samples.

Environmental ranges
  Depth range (m): 0 - 141
  Temperature range (°C): 7.337 - 25.874
  Nitrate (umol/L): 0.289 - 7.566
  Salinity (PPS): 32.507 - 36.266
  Oxygen (ml/l): 4.550 - 6.494
  Phosphate (umol/l): 0.092 - 0.736
  Silicate (umol/l): 0.756 - 4.869

Graphical representation

Depth range (m): 0 - 141

Temperature range (°C): 7.337 - 25.874

Nitrate (umol/L): 0.289 - 7.566

Salinity (PPS): 32.507 - 36.266

Oxygen (ml/l): 4.550 - 6.494

Phosphate (umol/l): 0.092 - 0.736

Silicate (umol/l): 0.756 - 4.869
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 36m.
From 1 to 36 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs down to about 36 mm, but more commonly in shallow tidal areas with muddy bottoms and brackish waters, euryhaline (virtually fresh to fully saline or even hypersaline); found only in spring and summer in the tidal portion of the Ochlokonee River, Florida. See Ref. 42268.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mostly zooplankton; also benthic organisms when zooplankton scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay anchovies are primarily zooplanktivorous DeLancey (1989) listed brachyuran crustacean megalopae (larvae), copepods, and mysids as the most important prey items recovered from the guts of A. mitchilli collected from a South Carolina beach surf zone. Predators: Bay anchovies are a major component in the diets of several species of piscivorous fish, including commercially important species such as weakfish (Cynoscion regalis), and striped bass (Morone saxatilis) (Baird and Ulanowicz 1989). Chain Pickerel (Esox niger) have also been reported as predators of bay anchovies (Meyers and Muncy 1962).Safina and Burger (1989) indicate bay anchovies are one of two prey fish species most preyed upon by predatory fish and terns near Fire Island Inlet, NY. Bluefish (Pomatomus saltatrix) were identified as a major consumer of bay anchovies by these authors, and appear capable of altering anchovy population numbers through predation. McGinnis and Emslie (2001) report North Carolina royal Terns (Sterna maxima) and sandwich terns (S. sandvicensis) both prey on bay anchovies.A strong association between bay anchovies and the Atlantic brief squid (Lolliguncula brevis) in a study by Ogburn-Matthews and Allen (1993) is likely reflective of a strong predator-prey relationship between these species. Gelatinous predators such as sea nettles (Chrysaora quinquecirrha) end ctenophores (e.g., Mnemiopsis leidyi) are known to consume bay anchovy eggs (Breitburg et al. 1997, Rilling and Houde 1999). Habitats: Anchoa mitchilli is primarily a pelagic (water colum) species, a habitat preference that is consistent with the zooplanktivorous dietary habits of the species. Individuals are encountered over seagrass beds and unvegetated benthic areas (Orth and Heck 1980). Castellanos and Rozas (2001) collected more individuals over bare substrata than over vegetated areas. Bay anchovies occur in protected waters and tide pools as well as in beach surf zones (Crabtree and Dean 1982, DeLancey 1989). Activity Time: Castillo-Rivera et al. (1994) captured significantly more bay anchovies in nighttime collections and suggested the nocturnal activity pattern might be a predator avoidance strategy.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: total adult population size is unknown but presumably exceeds 1,000,000. This fish is regarded as abundant in suitable habitat (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay anchovies are often seasonal numerical dominants in areas in which they occur. Castillo-Rivera et al. (1994) report A. mitchilli accounted for 55% of all fish caught in an ichthyofaunal study of Pueblo Viejo Lagoon, Veracruz, Mexico. Peak abundance in this study occurred during September and October with a general increase in abundance during the wet season. Szedlmayer and Able (1996) note that bay anchovies accounted for more than half of all fish caught in their study of a southern New Jersey estuary fish community.Rilling and Houde (1999) state that A. mitchilli is the most abundant fish in Chesapeake Bay.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in spring-summer over much of Atlantic coast, all year in southern Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anchoa mitchilli is a a pelagic, serial spawner (Luo and Musick 1991, Zastrow et al. 1991). Szedlmayer and Able (1996) report that the species spawns both within estuaries and offshore over the continental shelf. Fives et al. (1986) suggest that individuals become sexually mature once they exceed 40 mm SL.Field surveys by Rilling and Houde (1999) revealed that bay anchovy spawning in Chesapeake Bay occurred from May through September and peaked during July in the seaward third of the bay. The authors estimate that baywide daily egg production increased from 4.25 x 1012 in June to 8.43 X 1012 in July. Olney (1983) reports that 99% of fish egg catches and 67-88% of larval catches during this period are bay anchovies. During peak spawning, pelagic egg densities range from 10-1,000/m3 and larval densities reach 1-100/m3 (Olney 1983, Dalton 1987).In the southern portion of its geographic distribution, spawning appears to occur year-round (Houde and Lovdal 1984).
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Larval duration in bay anchovies from the Newport River Estuary, NC, is around 45 days, at which time individuals of approximately 22.5 mm complete metamorphosis. Rapid larval growth rates likely allow animals spawned early in the season (May to early June) to mature and spawn by late summer or early fall of the same year (Fives et al. 1986).Jordan et al. (2000) reports that Anchoa mitchilli larval growth rates are spatially and temporally variable, averaging 0.39-0.88 mm/day over two seasons of field investigation in the mid Hudson River Estuary. The authors postulate that small-scale zooplankton patchiness, not salinity or temperature differences, governed growth rate variation.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Anchoa mitchilli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Anchoa mitchilli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTATTTTCGGTGCCTGAGCAGGAATAGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTTCTGGGGGACGATCAGATTTACAATGTAATTGTGACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATGCCTATCCTAATCGGCGGGTTCGGGAACTGACTGGTCCCCTTAATACTAGGGGCCCCAGACATAGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCTCCATCATTTCTCCTTCTTCTTGCATCATCTGGGGTTGAAGCAGGGGCCGGAACGGGGTGAACAGTTTACCCCCCTCTAGCAGGAAATTTAGCCCATGCAGGAGCGTCAGTAGATCTAACAATCTTCTCTCTCCACCTAGCAGGTATCTCATCAATCTTAGGTGCCATCAACTTTATTACCACTATCATTAACATGAAACCGCCTGCAATCTCACAATATCAGACACCTTTATTTGTCTGAGCCGTGTTAATTACAGCAGTACTTTTACTTCTTTCACTTCCTGTTCTAGCTGCCGGGATTACTATACTTCTTACAGATCGAAATCTAAATACCACCTTCTTCGACCCAGCAGGGGGAGGAGATCCCATTCTTTATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large range extent, large population, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range and high abundance along the Atlantic and Gulf coasts of North America; no major threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but presumably exceeds 1,000,000. This fish is regarded as abundant in suitable habitat (Page and Burr 2011).

Trend over the past 10 years or three generations is uncertain but probably relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable.

Global Long Term Trend: Relatively stable (=10% change)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Anchoa spp. are caught as non-target species and/or bycatch off Mexico (Fernández et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; bait: usually; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic/Ecological Importance: Bay anchovies are economically important as a "trashfish" harvest fishery species used for fish oil and fishmeal. It also represents a critical component of marine and estuarine food webs, both as a predator and a prey species.
  • Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
  • Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
  • Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
  • Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
  • Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
  • Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
  • Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
  • Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
  • Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
  • DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
  • Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
  • Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
  • Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
  • Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
  • Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
  • Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
  • McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
  • Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
  • Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
  • Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
  • Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
  • Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
  • Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
  • Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
  • Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
  • Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
  • Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Anchoa mitchilli

Anchoa mitchilli is a species of fish in the Engraulidae family. It also commonly goes by the name "Bay anchovy."

Etymology[edit]

The word Anchoa comes from the Spanish word anchova meaning "herring-like" or a herring like fish. The species name Mitchilli was named in honor of Dr. Samuel L. Mitchill, a New York senator and American naturalist who wrote several documents on North American fishes.

Description[edit]

The Anchoa mitchilli or "Bay Anchovy" is a small, slender, schooling fish with a greenish body and a silvery stripe that runs along the body. It is characterized by its very long jaw, silvery belly, lateral stripe, and single dorsal fin. The dorsal fin is located directly above the anal fin origin.[1] The dorsal fin contains 12 to 14 rays and the anal fin contains 24 to 27 rays. Bay anchovies can grow up to a total length of 100 mm (4 inches).[2] They are considered the smallest anchovy species occurring in South Carolina.

Habitiat and Biology[edit]

The bay anchovy is the most abundant and important species native to the Chesapeake Bay. Bay anchovies, as other members of the family Engraulidae, typically aggregate in large schools. Schooling occurs in deep waters during winter and moves into the shallows in warmer months. The bay anchovy is also widely tolerant of salinity and temperature. Specific habitat features, structure, and shoreline development are not particular concern for bay anchovy, but hydrographic features that affect water quality could limit its distribution and abundance. They feed mostly on zooplankton. They are planktivorous fish which use gill rakers—comb-like structures on their gill arches—to strain the water for food. Bay anchovies can live up until the age of three but usually live around the age of two.

Reproduction[edit]

Bay anchovies spawn from spring through late summer, once water temperatures reach at least 54 degrees. The peak of spawning occurs in July (late spring) and summer when low dissolved oxygen (DO) may limit the distribution of all life stages.[3] Oxygen levels below 3.0 mgl-1 can be lethal to eggs and larvae and DO below 2.0 mgl-1 is critical. In South Carolina, spawning occurs in the evening during the summer months. Eggs are pelagic, and larvae hatch within 24 hours. Growth in this species is rapid, especially at higher temperatures, with a fish reaching maturity a few months after hatching.[4]

Predation[edit]

Bay anchovies are an important source of food for predatory fish, including the sea trout, southern flounder, striped bass, bluefish, and weakfish. Although the species itself has no recreational or commercial value, it fulfills a crucial role in the coastal food web.[5]

Anchoa mitchelli vs Anchoa hepsetus[edit]

Compared to the co- occurring and larger striped anchovy, Anchoa hepsetus, the bay anchovy has a shorter snout and the silvery stripe on the side of the body is less distinct. Bay anchovies are characterized by a single dorsal fin, a silvery head and lateral stripe, silvery belly and a very long jaw. The larger striped anchovy has a more distinct lateral stripe and longer snout (longer than eye diameter).[6] Bay anchovies (and other anchovy species) are similar in appearance to fishes of the herring family (Clupeidae). However, they can be distinguished by a prominent silver stripe on either side of the body and lack of scutes (bony scales) along their bellies. Bay anchovies are of a greenish color above and silvery below and have a single dorsal fin, which is located midway along the body. They are often confused with silversides (Menidia spp.),[7] but the two can be easily distinguished—anchovies lack a spine in the dorsal fin and have a large, gaping mouth that extends almost to the edge of the opercle, whereas silversides have two distinct dorsal fins, the first with four spines, and a very small mouth that is tilted upwards.[8]

Decline[edit]

Bay anchovy populations in the Chesapeake Bay fluctuate annually, however the Maryland Department of Natural Resources Juvenile Finfish Seining Survey indicates the bay anchovy has suffered from poor recruitment in recent years.[9] Bay anchovy numbers have shown a dramatic decline since 1994 in Maryland's portion of the Chesapeake Bay and its tributaries documenting the first long-term decline ever recorded for the species. The 1997 Juvenile Finfish Seining Survey Index for bay anchovy is the lowest on record.

In the past few years bay anchovies have been the prevalent forage fish in the Buzzard's bay area of Massachusetts. Clouds of them are seen on any bottom with structure throughout the summer months. Previously Menhaden were the prevalent forage fish but have been scarce recently and the void seems to be filled by the smaller bay anchovy.[citation needed]

References[edit]

  1. ^ [DeLancey, Larry. Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources. http://www.dnr.sc.gov/cwcs/pdf/Bayanchovy.pdf]
  2. ^ [Chesapeake Bay Program. Bay Field Guide. Bay Anchovy Anchoa mitchilli http://www.chesapeakebay.net/bfg_bayanchovy.aspx?menuitem=32815]
  3. ^ [Bay Anchovy Data. Anchoa mitchilli Chesapeake Bay Ecological Foundation, Inc. 2011 http://www.chesbay.org/forageFish/anchovy.asp]
  4. ^ [Bay Anchovy Data. Anchoa mitchilli Chesapeake Bay Ecological Foundation, Inc. 2011 http://www.chesbay.org/forageFish/anchovy.asp]
  5. ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
  6. ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
  7. ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
  8. ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
  9. ^ [Bay Anchovy "Anchovy mitchilli" Maryland Department of Natural Resources http://www.dnr.state.md.us/bay/cblife/fish/bay_anchovy.html]

Chesapeake Bay Program. Bay Field Guide. Bay Anchovy Anchoa mitchilli http://www.chesapeakebay.net/bfg_bayanchovy.aspx?menuitem=32815

Bay Anchovy Data. Anchoa mitchilli Chesapeake Bay Ecological Foundation, Inc. 2011 http://www.chesbay.org/forageFish/anchovy.asp Bay Anchovy "Anchovy mitchilli" Maryland Department of Natural Resources http://www.dnr.state.md.us/bay/cblife/fish/bay_anchovy.html

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!