Table of Contents
Overview
Comprehensive Description
Biology
More commonly found in shallow tidal areas with muddy bottoms and brackish waters, tolerating a wide range of salinities (virtually fresh to fully saline or hypersaline). Found only in spring and summer in the tidal portion of the Ochlockonee River, Florida. Feed mostly on Mysis and copepods, also small fishes, gastropods and isopods. Breed off North Carolina from late April to mid-July, perhaps through to August. Used to some extent to make anchovy paste (Ref. 189).
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
The bay anchovy, Anchoa mitchili, is a common and often extremely abundant fish of coastal and inshore waters of the western Atlantic. It is gray with a short head and a very short snout and a narrow silvery stripe about as wide as the pupil of the eye, running along the sides of the body. The dorsal fin is set far back on the body, just above or slightly in front of the insertion point for the anal fin. Ray counts are: dorsal = 14-16; anal = 24-30; pectoral = 11-12 (Hoese and Moore 1977, Robbins et al. 1986).
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Distribution
Western Atlantic: Casco Bay, Maine south to Florida Keys and westward around the Gulf of Mexico south to Yucatán; not in the West Indies.
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Western Atlantic: from Casco Bay, Maine south to Florida Keys and westward around the Gulf of Mexico south to Yucatán
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Gulf of Maine, Gulf of Mexico, North West Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
National Distribution
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
© NatureServe
Source:
NatureServe
Trusted
Global Range: Western Atlantic and Gulf of Mexico coast, Maine to Yucatan.
© NatureServe
Source:
NatureServe
Trusted
Bay anchovies occur from the Gulf of Maine and Cape Cod, MA, south to Yucatan, Mexico, and throughout the Gulf of Mexico (Hoese and Moore 1977, Fives et al. 1986, Robbins et al. 1986). Bay anchovies occur throughout the India River Lagoon system.
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 23 - 31
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Size
Max. size
10.0 cm SL (male/unsexed; (Ref. 189))
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Bay anchovies typically grow to around 10 cm length (Robbins et al. 1986).Able et al. (2001) report Anchoa mitchilli populations are composed of multiple year-classes in Delaware Bay marsh creeks, suggesting a lifespan of more than one year.
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Diagnostic Description
Body variable, more slender in northern populations. Snout fairly blunt, a little over 1/2 eye diameter; maxilla long, tip pointed, reaching beyond hind border of pre-operculum, almost to gill opening; panamensis-type gill cover canals. Anal fin rays rarely 28, its origin below unbranched dorsal fin rays. Anus nearer to pelvic fin tips than to anal fin origin.
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Type Information
Paratype for Anchoa mitchilli
Catalog Number: USNM 127740
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Louisiana: Bastian Bag, Louisiana, United States, Gulf of Mexico, Atlantic
Catalog Number: USNM 127740
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Louisiana: Bastian Bag, Louisiana, United States, Gulf of Mexico, Atlantic
- Paratype: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Anchoa mitchilli
Catalog Number: USNM 127735
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
Catalog Number: USNM 127735
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
- Paratype: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Anchoa mitchilli
Catalog Number: USNM 127733
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
Catalog Number: USNM 127733
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
- Paratype: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Type for Anchoa mitchilli
Catalog Number: USNM 119790
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
Catalog Number: USNM 119790
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): I. Ginsburg
Year Collected: 1930
Locality: Grand Isle, Louisiana., Louisiana, United States, Gulf of Mexico, Atlantic
- Type: Hildebrand, S. F. 1943. Bulletin of the Bingham Oceanographic Collection. 8 (art. 2): 91.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Look Alikes
Bay anchovies are similar in appearance to two other common Anchoaspecies with which it co-occurs throughout much of Florida. The striped anchovy (Anchoa hepsetus) often grows to be somewhat larger (to 15 cm) than the bay anchovy, and both it and the Cuban anchovy (A. cubana) have a dorsal fin that begins well in front of the anal fin. Bay anchovies are the only US anchovies in which the dorsal fin begins at a point right above or only very slightly in front of where the anal fin begins (Robbins et al. 1986).
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Ecology
Habitat
Environment
pelagic-neritic; amphidromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 36 m (Ref. 189)
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Depth range based on 2294 specimens in 1 taxon.
Water temperature and chemistry ranges based on 567 samples.
Environmental ranges
Depth range (m): 0 - 141
Temperature range (°C): 7.337 - 25.874
Nitrate (umol/L): 0.289 - 7.566
Salinity (PPS): 32.507 - 36.266
Oxygen (ml/l): 4.550 - 6.494
Phosphate (umol/l): 0.092 - 0.736
Silicate (umol/l): 0.756 - 4.869
Graphical representation
Depth range (m): 0 - 141
Temperature range (°C): 7.337 - 25.874
Nitrate (umol/L): 0.289 - 7.566
Salinity (PPS): 32.507 - 36.266
Oxygen (ml/l): 4.550 - 6.494
Phosphate (umol/l): 0.092 - 0.736
Silicate (umol/l): 0.756 - 4.869
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 567 samples.
Environmental ranges
Depth range (m): 0 - 141
Temperature range (°C): 7.337 - 25.874
Nitrate (umol/L): 0.289 - 7.566
Salinity (PPS): 32.507 - 36.266
Oxygen (ml/l): 4.550 - 6.494
Phosphate (umol/l): 0.092 - 0.736
Silicate (umol/l): 0.756 - 4.869
Graphical representation
Depth range (m): 0 - 141
Temperature range (°C): 7.337 - 25.874
Nitrate (umol/L): 0.289 - 7.566
Salinity (PPS): 32.507 - 36.266
Oxygen (ml/l): 4.550 - 6.494
Phosphate (umol/l): 0.092 - 0.736
Silicate (umol/l): 0.756 - 4.869
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Habitat Type: Freshwater
Comments: Lower freshwater and estuarine reaches of coastal rivers, bays, sounds, high salinity nearshore marine waters; usually at depths of less than 20 m.
© NatureServe
Source:
NatureServe
Trusted
Depth: 1 - 36m.
From 1 to 36 meters.
Habitat: pelagic.
From 1 to 36 meters.
Habitat: pelagic.
© FishWise Professional
Source:
FishWise Professional
Trusted
Migration
Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© FishBase
Source:
FishBase
Trusted
Non-Migrant: No. All populations of this species make significant seasonal migrations.
Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).
Locally Migrant: No. No populations of this species make annual migrations of over 200 km.
© NatureServe
Source:
NatureServe
Trusted
Trophic Strategy
Occurs down to about 36 mm, but more commonly in shallow tidal areas with muddy bottoms and brackish waters, euryhaline (virtually fresh to fully saline or even hypersaline); found only in spring and summer in the tidal portion of the Ochlokonee River, Florida. See Ref. 42268.
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Comments: Eats mostly zooplankton; also benthic organisms when zooplankton scarce.
© NatureServe
Source:
NatureServe
Trusted
Bay anchovies are primarily zooplanktivorous DeLancey (1989) listed brachyuran crustacean megalopae (larvae), copepods, and mysids as the most important prey items recovered from the guts of A. mitchilli collected from a South Carolina beach surf zone. Predators: Bay anchovies are a major component in the diets of several species of piscivorous fish, including commercially important species such as weakfish (Cynoscion regalis), and striped bass (Morone saxatilis) (Baird and Ulanowicz 1989). Chain Pickerel (Esox niger) have also been reported as predators of bay anchovies (Meyers and Muncy 1962).Safina and Burger (1989) indicate bay anchovies are one of two prey fish species most preyed upon by predatory fish and terns near Fire Island Inlet, NY. Bluefish (Pomatomus saltatrix) were identified as a major consumer of bay anchovies by these authors, and appear capable of altering anchovy population numbers through predation. McGinnis and Emslie (2001) report North Carolina royal Terns (Sterna maxima) and sandwich terns (S. sandvicensis) both prey on bay anchovies.A strong association between bay anchovies and the Atlantic brief squid (Lolliguncula brevis) in a study by Ogburn-Matthews and Allen (1993) is likely reflective of a strong predator-prey relationship between these species. Gelatinous predators such as sea nettles (Chrysaora quinquecirrha) end ctenophores (e.g., Mnemiopsis leidyi) are known to consume bay anchovy eggs (Breitburg et al. 1997, Rilling and Houde 1999). Habitats: Anchoa mitchilli is primarily a pelagic (water colum) species, a habitat preference that is consistent with the zooplanktivorous dietary habits of the species. Individuals are encountered over seagrass beds and unvegetated benthic areas (Orth and Heck 1980). Castellanos and Rozas (2001) collected more individuals over bare substrata than over vegetated areas. Bay anchovies occur in protected waters and tide pools as well as in beach surf zones (Crabtree and Dean 1982, DeLancey 1989). Activity Time: Castillo-Rivera et al. (1994) captured significantly more bay anchovies in nighttime collections and suggested the nocturnal activity pattern might be a predator avoidance strategy.
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Associations
Known predators
Anchoa mitchilli (Atlantic silversides and bay anchovy) is prey of:
Anchoa mitchilli
Leiostomus xanthurus
Morone americana
Arius felis
Pomatomus saltatrix
Odostomia seminuda
Acanthocitona pygmaea
Hylina veliei
Spirals
Nudibranchia
Polinices
Terebra
Seila adamsi
Epitonium albidum
Opalia hotessieriana
Natica pusilla
Urosalpinx perrugata
Busycon spiratum
Marginella aureocincta
Marginella apicina
Marginella bella
Turbonilla dalli
Turbonilla hemphilli
Lophodytes cucullatus
Tringa melanoleuca
Catoptrophorus semipalmatus
Larus argentatus
Larus delawarensis
Larus atricilla
Sterna forsteri
sediment POC
Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)
USA: Florida (Estuarine)
This list may not be complete but is based on published studies.
Anchoa mitchilli
Leiostomus xanthurus
Morone americana
Arius felis
Pomatomus saltatrix
Odostomia seminuda
Acanthocitona pygmaea
Hylina veliei
Spirals
Nudibranchia
Polinices
Terebra
Seila adamsi
Epitonium albidum
Opalia hotessieriana
Natica pusilla
Urosalpinx perrugata
Busycon spiratum
Marginella aureocincta
Marginella apicina
Marginella bella
Turbonilla dalli
Turbonilla hemphilli
Lophodytes cucullatus
Tringa melanoleuca
Catoptrophorus semipalmatus
Larus argentatus
Larus delawarensis
Larus atricilla
Sterna forsteri
sediment POC
Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)
USA: Florida (Estuarine)
This list may not be complete but is based on published studies.
- Christian RR, Luczkovich JJ (1999) Organizing and understanding a winters seagrass foodweb network through effective trophic levels. Ecol Model 117:99124
- Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329364
© SPIRE project
Source:
SPIRE
Trusted
Known prey organisms
Anchoa mitchilli (Atlantic silversides and bay anchovy) preys on:
phytoplankton
microzooplankton
zooplankton
Ctenophora
Chrysaora quinquecirrha
Other suspension feeders
Mya arenaria
Crassostrea virginica
Polychaeta
Nereis
Macoma
Anchoa mitchilli
Alosa sapidissima
Micropogonius undulatus
Trinectes maculatus
Leiostomus xanthurus
algae
Elasmopus levis
Lembos rectangularis
Acunmindeutopus naglei
Synchelidium
Ampithoe longimana
Cymadusa compta
Batea catharinensis
Listriella barnardi
Lysianopsis alba
Caprella penantis
Sabellidae
Serpulidae
Amphipoda
Ophioderma brevispinum
Alpheus normani
Hippolyte zostericola
Amphitritidae
Pectanaridae
Hylina veliei
Syllidae
Orbiniidae
Paraonidae
Spionidae
Cirratulidae
Capitellidae
Maldanidae
Aricidea
Jaspidella jaspidea
Nemertines
Nereidae
Hesionidae
Glyceridae
Onuphidae
Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)
USA: Florida (Estuarine)
This list may not be complete but is based on published studies.
phytoplankton
microzooplankton
zooplankton
Ctenophora
Chrysaora quinquecirrha
Other suspension feeders
Mya arenaria
Crassostrea virginica
Polychaeta
Nereis
Macoma
Anchoa mitchilli
Alosa sapidissima
Micropogonius undulatus
Trinectes maculatus
Leiostomus xanthurus
algae
Elasmopus levis
Lembos rectangularis
Acunmindeutopus naglei
Synchelidium
Ampithoe longimana
Cymadusa compta
Batea catharinensis
Listriella barnardi
Lysianopsis alba
Caprella penantis
Sabellidae
Serpulidae
Amphipoda
Ophioderma brevispinum
Alpheus normani
Hippolyte zostericola
Amphitritidae
Pectanaridae
Hylina veliei
Syllidae
Orbiniidae
Paraonidae
Spionidae
Cirratulidae
Capitellidae
Maldanidae
Aricidea
Jaspidella jaspidea
Nemertines
Nereidae
Hesionidae
Glyceridae
Onuphidae
Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)
USA: Florida (Estuarine)
This list may not be complete but is based on published studies.
- Christian RR, Luczkovich JJ (1999) Organizing and understanding a winters seagrass foodweb network through effective trophic levels. Ecol Model 117:99124
- Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329364
© SPIRE project
Source:
SPIRE
Trusted
Population Biology
Bay anchovies are often seasonal numerical dominants in areas in which they occur. Castillo-Rivera et al. (1994) report A. mitchilli accounted for 55% of all fish caught in an ichthyofaunal study of Pueblo Viejo Lagoon, Veracruz, Mexico. Peak abundance in this study occurred during September and October with a general increase in abundance during the wet season. Szedlmayer and Able (1996) note that bay anchovies accounted for more than half of all fish caught in their study of a southern New Jersey estuary fish community.Rilling and Houde (1999) state that A. mitchilli is the most abundant fish in Chesapeake Bay.
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Life History and Behavior
Reproduction
Spawns in spring-summer over much of Atlantic coast, all year in southern Florida.
© NatureServe
Source:
NatureServe
Trusted
Anchoa mitchilli is a a pelagic, serial spawner (Luo and Musick 1991, Zastrow et al. 1991). Szedlmayer and Able (1996) report that the species spawns both within estuaries and offshore over the continental shelf. Fives et al. (1986) suggest that individuals become sexually mature once they exceed 40 mm SL.Field surveys by Rilling and Houde (1999) revealed that bay anchovy spawning in Chesapeake Bay occurred from May through September and peaked during July in the seaward third of the bay. The authors estimate that baywide daily egg production increased from 4.25 x 1012 in June to 8.43 X 1012 in July. Olney (1983) reports that 99% of fish egg catches and 67-88% of larval catches during this period are bay anchovies. During peak spawning, pelagic egg densities range from 10-1,000/m3 and larval densities reach 1-100/m3 (Olney 1983, Dalton 1987).In the southern portion of its geographic distribution, spawning appears to occur year-round (Houde and Lovdal 1984).
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Growth
Larval duration in bay anchovies from the Newport River Estuary, NC, is around 45 days, at which time individuals of approximately 22.5 mm complete metamorphosis. Rapid larval growth rates likely allow animals spawned early in the season (May to early June) to mature and spawn by late summer or early fall of the same year (Fives et al. 1986).Jordan et al. (2000) reports that Anchoa mitchilli larval growth rates are spatially and temporally variable, averaging 0.39-0.88 mm/day over two seasons of field investigation in the mid Hudson River Estuary. The authors postulate that small-scale zooplankton patchiness, not salinity or temperature differences, governed growth rate variation.
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Anchoa mitchilli
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTATCTTATTTTCGGTGCCTGAGCAGGAATAGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTTCTGGGGGACGATCAGATTTACAATGTAATTGTGACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATGCCTATCCTAATCGGCGGGTTCGGGAACTGACTGGTCCCCTTAATACTAGGGGCCCCAGACATAGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCTCCATCATTTCTCCTTCTTCTTGCATCATCTGGGGTTGAAGCAGGGGCCGGAACGGGGTGAACAGTTTACCCCCCTCTAGCAGGAAATTTAGCCCATGCAGGAGCGTCAGTAGATCTAACAATCTTCTCTCTCCACCTAGCAGGTATCTCATCAATCTTAGGTGCCATCAACTTTATTACCACTATCATTAACATGAAACCGCCTGCAATCTCACAATATCAGACACCTTTATTTGTCTGAGCCGTGTTAATTACAGCAGTACTTTTACTTCTTTCACTTCCTGTTCTAGCTGCCGGGATTACTATACTTCTTACAGATCGAAATCTAAATACCACCTTCTTCGACCCAGCAGGGGGAGGAGATCCCATTCTTTATCAACACCTATTC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Anchoa mitchilli
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 36
Species With Barcodes: 1
Public Records: 8
Specimens with Barcodes: 36
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Conservation Status
National NatureServe Conservation Status
United States
Rounded National Status Rank: N5 - Secure
© NatureServe
Source:
NatureServe
Trusted
NatureServe Conservation Status
Rounded Global Status Rank: G5 - Secure
© NatureServe
Source:
NatureServe
Trusted
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; bait: usually; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
-
Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
http://www.fishbase.org/references/FBRefSummary.php?id=171&speccode=2534
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Economic/Ecological Importance: Bay anchovies are economically important as a "trashfish" harvest fishery species used for fish oil and fishmeal. It also represents a critical component of marine and estuarine food webs, both as a predator and a prey species.
- Hoese HD and RH Moore. 1977. Fishes of the Gulf of Mexico. Texas, Louisiana, and Adjacent Waters. Texas A&M University Press, College Station TX. 327 p.
- Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 p.
- Able KW, Nemerson DM, Bush R, and P Light. 2001. Spatial variation in Delaware Bay marsh creek fish assemblages. Estuaries 24:441-452.
- Baird D and RE Ulanowicz. 1989. The seasonal dynamics of the Chesapeake Bay ecosystem. Ecological Monographs 59: 329-364.
- Breitburg DL. 1994. Behavioral response of fish larvae to low dissolved oxygen concentrations in a stratified water column. Marine Biology 120:615-625.
- Breitburg DL, Loher T, Pacey CA, and A Gerstein. 1997. Varying effects of low dissolved oxygen on trophic interactions in an estuarine food web. Ecological Monographs 67:489-507.
- Castellanos DL and LP Rozas. 2001. Nekton use of submerged aquatic vegetation, marsh, and shallow unvegetated bottom in the Atchafalaya River Delta, a Louisiana tidal freshwater ecosystem. Estuaries 24:184-197.
- Castillo-Rivera M, Moreno G, and R Iniestra. 1994. Spatial, seasonal, and diel variation in abundance of the bay anchovy, Anchoa mitchilli (Teleostei: Engraulidae), in a tropical coastal lagoon of Mexico. The Southwestern Naturalist 39:263-268.
- Crabtree RE and JM Dean. 1982. The structure of two South Carolina estuarine tide pool fish assemblages. Estuaries 5:2-9.
- Dalton PD. 1987. Ecology of bay anchovy, Anchoa mitchilli, eggs and larvae in the mid-Chesapeake Bay. Unpublished Masters Thesis, University of Maryland, College Park, Maryland.
- DeLancey LB. 1989. Trophic relationship in the surf zone during the summer at Folly Beach, South Carolina. Journal of Coastal Research 5:477-488.Felley JD. 1983. Nekton assemblages of three tributaries to the Calcasieu Estuary, Louisiana. Estuaries 10:321-329.
- Fives JM, Warlen SM, and DE Hoss. 1986. Aging and growth of larval bay anchovy, Anchoa mitchilli, from the Newport River Estuary, North Carolina. Estuaries 9:362-367.
- Gelwick FP, Akin S, Arrington DA, and KO Winemiller. 2001. Fish assemblage structure in relation to environmental variation in a Texas Gulf coastal wetland. Estuaries 24:285-296.
- Gunter G. 1947. Differential rate of death for large and small fishes caused by hard cold waves. Science, New Series 106, No. 2759:472.
- Houde SD and JA Lovdal. 1984. Seasonality of occurrence, foods and food of ichthyoplankton in Biscayne Bay, Florida. Estuarine Coastal Shelf Science 18:403-419.
- Jordan RC, Gospodarek AM, Schultz ET, Cowen RK, and K Lwiza. 2000. Spatial and temporal growth rate variation of bay anchovy (Anchoa mitchilli) larvae in the mid Hudson River Estuary. Estuaries 23:683-689.
- Luo J and JA Musick. 1991. Reproductive biology of the bay anchovy in Chesapeake Bay. Transactions of the American Fisheries Society 120:701-710.
- McGinnis TW and SD Emslie. 2001. The foraging ecology of royal and sandwich terns in North Carolina, USA. Waterbirds: The International Journal of Waterbird Biology 24:361-370.
- Meyers CD and RJ Muncy. 1962. Summer food and growth of chain pickerel, Esox niger, in brackish waters of the Severn River, Maryland. Chesapeake Science 3:125-128.
- Ogburn-Matthews MV and DM Allen. 1993. Interactions among some dominant estuarine nekton species. Estuaries 16:840-850.
- Olney JE. 1983. Eggs and early larvae of the bay anchovy, Anchoa mitchilli, and the weakfish, Cynoscion regalis, in lower Chesapeake Bay with notes on associated ichthyoplankton. Estuaries 6:20-35.
- Orth RJ and KL Heck Jr. 1980. Structural components of eelgrass (Zostera marina) meadows in the Lower Chesapeake Bay: Fishes. Estuaries 3:278-288.
- Parker RS, Hackney CT, and MF Vidrine. 1984. Ecology and reproductive strategy of a South Louisiana freshwater mussel, Glebula rotundata (Lamarck) (Unionidae:Lampsilini). Freshwater Invertebrate Biology 3:53-58.
- Rilling GC and ED Houde. 1999. Regional and temporal variability in distribution and abundance of bay anchovy (Anchoa mitchilli) eggs, larvae, and adult biomass in the Chesapeake Bay. Estuaries 22:1096-1109.
- Rozas LP and CT Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
- Safina C and J Burger. Population interactions among free-living bluefish and prey fish in an ocean environment. Oecologia 79:91-95.
- Simmons EG. 1957. An ecological survey of the upper Laguna Madre of Texas. Publications of the Institute for Marine Science, University of Texas 4:156-200.
- Szedlmayer ST and KW Able. 1996. Patterns of seasonal availability and habitat use by fishes and decapod crustaceans in a southern New Jersey estuary. Estuaries 19:697-709.
- Zastrow CE, Houde ED, and LG Morin. 1991. Spawning, fecundity, hatch-date frequency and young-of-the-year growth of bay anchovy, Anchoa mitchilli in mid-Chesapeake Bay. Marine Ecology Progress Series 73:161-171.
© Smithsonian Marine Station at Fort Pierce
Trusted
Wikipedia
Anchoa mitchilli
 | This article needs additional citations for verification. (December 2011) |
Anchoa mitchilli is a species of fish in the Engraulidae family. It also commonly goes by the name "Bay anchovy."
Contents |
Etymology
The word Anchoa comes from the Spanish word anchova meaning "herring-like" or a herring like fish. The species name Mitchilli was named in honor of Dr. Samuel L. Mitchill, a New York senator and American naturalist who wrote several documents on North American fishes.
Description
The Anchoa mitchilli or "Bay Anchovy" is a small, slender, schooling fish with a greenish body and a silvery stripe that runs along the body. It is characterized by its very long jaw, silvery belly, lateral stripe, and single dorsal fin. The dorsal fin is located directly above the anal fin origin.[1] The dorsal fin contains 12 to 14 rays and the anal fin contains 24 to 27 rays. Bay anchovies can grow up to a total length of 100 mm (4 inches).[2] They are considered the smallest anchovy species occurring in South Carolina.
Habitiat and Biology
The bay anchovy is the most abundant and important species native to the Chesapeake Bay. Bay anchovies, as other members of the family Engraulidae, typically aggregate in large schools. Schooling occurs in deep waters during winter and moves into the shallows in warmer months. The bay anchovy is also widely tolerant of salinity and temperature. Specific habitat features, structure, and shoreline development are not particular concern for bay anchovy, but hydrographic features that affect water quality could limit its distribution and abundance. They feed mostly on zooplankton. They are planktivorous fish which use gill rakers—comb-like structures on their gill arches—to strain the water for food. Bay anchovies can live up until the age of three but usually live around the age of two.
Reproduction
Bay anchovies spawn from spring through late summer, once water temperatures reach at least 54 degrees. The peak of spawning occurs in July (late spring) and summer when low dissolved oxygen (DO) may limit the distribution of all life stages.[3] Oxygen levels below 3.0 mgl-1 can be lethal to eggs and larvae and DO below 2.0 mgl-1 is critical. In South Carolina, spawning occurs in the evening during the summer months. Eggs are pelagic, and larvae hatch within 24 hours. Growth in this species is rapid, especially at higher temperatures, with a fish reaching maturity a few months after hatching.[4]
Predation
Bay anchovies are an important source of food for predatory fish, including the sea trout, southern flounder, striped bass, bluefish, and weakfish. Although the species itself has no recreational or commercial value, it fulfills a crucial role in the coastal food web.[5]
Anchoa mitchelli vs Anchoa hepsetus
Compared to the co- occurring and larger striped anchovy, Anchoa hepsetus, the bay anchovy has a shorter snout and the silvery stripe on the side of the body is less distinct. Bay anchovies are characterized by a single dorsal fin, a silvery head and lateral stripe, silvery belly and a very long jaw. The larger striped anchovy has a more distinct lateral stripe and longer snout (longer than eye diameter).[6] Bay anchovies (and other anchovy species) are similar in appearance to fishes of the herring family (Clupeidae). However, they can be distinguished by a prominent silver stripe on either side of the body and lack of scutes (bony scales) along their bellies. Bay anchovies are of a greenish color above and silvery below and have a single dorsal fin, which is located midway along the body. They are often confused with silversides (Menidia spp.),[7] but the two can be easily distinguished—anchovies lack a spine in the dorsal fin and have a large, gaping mouth that extends almost to the edge of the opercle, whereas silversides have two distinct dorsal fins, the first with four spines, and a very small mouth that is tilted upwards.[8]
Decline
Bay anchovy populations in the Chesapeake Bay fluctuate annually, however the Maryland Department of Natural Resources Juvenile Finfish Seining Survey indicates the bay anchovy has suffered from poor recruitment in recent years.[9] Bay anchovy numbers have shown a dramatic decline since 1994 in Maryland's portion of the Chesapeake Bay and its tributaries documenting the first long-term decline ever recorded for the species. The 1997 Juvenile Finfish Seining Survey Index for bay anchovy is the lowest on record.
References
- ^ [DeLancey, Larry. Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources. http://www.dnr.sc.gov/cwcs/pdf/Bayanchovy.pdf]
- ^ [Chesapeake Bay Program. Bay Field Guide. Bay Anchovy Anchoa mitchilli http://www.chesapeakebay.net/bfg_bayanchovy.aspx?menuitem=32815]
- ^ [Bay Anchovy Data. Anchoa mitchilli Chesapeake Bay Ecological Foundation, Inc. 2011 http://www.chesbay.org/forageFish/anchovy.asp]
- ^ [Bay Anchovy Data. Anchoa mitchilli Chesapeake Bay Ecological Foundation, Inc. 2011 http://www.chesbay.org/forageFish/anchovy.asp]
- ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
- ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
- ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
- ^ [Bay Anchovy Anchoa mitchilli South Carolina Department of Natural Resources http://www.dnr.sc.gov/marine/mrri/acechar/specgal/bayanch.htm]
- ^ [Bay Anchovy "Anchovy mitchilli" Maryland Department of Natural Resources http://www.dnr.state.md.us/bay/cblife/fish/bay_anchovy.html]
Chesapeake Bay Program. Bay Field Guide. Bay Anchovy Anchoa mitchilli http://www.chesapeakebay.net/bfg_bayanchovy.aspx?menuitem=32815
Bay Anchovy Data. Anchoa mitchilli Chesapeake Bay Ecological Foundation, Inc. 2011 http://www.chesbay.org/forageFish/anchovy.asp Bay Anchovy "Anchovy mitchilli" Maryland Department of Natural Resources http://www.dnr.state.md.us/bay/cblife/fish/bay_anchovy.html
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
