Overview

Comprehensive Description

Biology

Inhabits coral reefs, inshore grassy or rocky areas. Forms small groups (Ref. 26235). Mainly diurnal. Feeds entirely on algae (Ref. 5521). At Fernando de Noronha Archipelago in southwestern Atlantic, juveniles hold cleaning stations together with the doctorfish (Acanthurus chirurgus) and sergeant major (Abudefduf saxatilis) and graze algae as well as pick molted skin and parasites from green turtles (Chelonia mydas). This behavior is preceded by a characteristic inspection usually followed by feeding nips on the turtles’ skin (head, limbs, and tail), as well as on the carapace. The most inspected and cleaned body parts are the flippers (Ref. 51385). The spine on both sides of the caudal peduncle may inflict painful wounds (Ref. 5217). Marketed fresh.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: New York, USA and Bermuda to the Gulf of Mexico and Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Acanthurus coeruleus is found from South Carolina, USA (juveniles to New York), Bermuda, southwards to Sao Paulo, Brazil (L. Rocha pers. comm. 2010). It is also reported from Ascension and St. Helena Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: New York, USA and Bermuda to the Gulf of Mexico and Brazil. Eastern Atlantic: Ascension Island (Ref. 7345).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Blue tangs, Acanthurus coeruleus, live on shallow marine reefs throughout the western Atlantic Ocean, the Gulf of Mexico, and the Caribbean Sea. Blue tangs range from New York in the north to the Amazon delta in Brazil. They are found east to Bermuda and Ascension Island but are most common in the Caribbean, and coastal Florida and the Bahamas.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western and central Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 26 - 28; Analspines: 3; Analsoft rays: 24 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Acanthurus coeruleus reaches 39 cm in length. A sexually mature fish is typically over 10 cm in length. Adult coloration is deep blue and occasionally purple. Mature fish are able to temporarily change color between near-black and pale white. These color shifts can encompass the entire fish or portions of it and are different between the sexes. Similar to other fishes in the family Acanthuridae, Acanthurus coeruleus is a laterally compressed, pancake-shaped fish with high eyes, a subterminal mouth, yellow caudal spine at the base of the tail, and a dorsal fin that ends at the caudal peduncle. Juveniles are bright yellow. Older juveniles are blue or orange-brown with grey stripes. The sharp caudal spine is found in a horizontal groove on the peduncle and can be extended during aggressive interactions. Acanthurus coeruleus has 9 dorsal spines, 26-28 dorsal soft rays, 3 anal spines, and 24-26 anal soft rays.

Range length: 39 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Deloach, N. 1999. Reef Fish Behavior:Florida Caribbean Bahamas. Jacksonville: New Worold Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 366 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

39.0 cm TL (male/unsexed; (Ref. 36453))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A deep-bodied surgeonfish (body depth 1.7 in SL) with a conspicuous yellow caudal spine. Has the most distinctive coloration of all western Atlantic surgeonfishes (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

inhabits coral reefs, inshore grassy or rocky areas; forms small groups
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Acanthurus coeruleus is found on coral reefs, rocky habitats and grassy areas in depths from 1 to 60 m. It grazes on a wide variety of benthic algae, occasionally on seagrass. It is sometimes seen in feeding aggregations with Acanthurus bahianus and/or A. chirurgus. In the Abrolhos Bank, all roving herbivorous species ingest large amounts of detritus with the exception of A. coeruleus. It is mainly a fleshy algae consumer (Ferreira and Goncalves 2006). The digestive tract contains little sand or inorganic material (Randall 2002a). It aggregates with other surgeonfishes (A. bahianus, A. tractus and A. chirurgus) to raid algae patches guarded by damselfishes.

Juveniles of this species are solitary and territorial (Bell and Kramer 2000) while adults commonly form mixed-species schools (Foster 1985) to facilitate access to defended high quality algal resources in damselfish territories (Robertson et al. 1976, Foster 1985). Schooling occurs primarily in adults; small juveniles never participate in large, dense schools. The proportion of adults that were schooling increased from the back reef to the reef crest to the spurs and grooves zone (Lawson et al. 1999).

A. coeruleus adults are consistently either territorial or non-territorial, with territorial individuals found in schools and wandering. Territorial adults engage in aggressive interactions with conspecific and congeners. Fish in the territorial mode restrict activity to a small area overlapping the territories of other tangs. Non-territorial fish form schools and wander (Morgan and Kramer 2004).

Growth

A. coeruleus displays the highly characterized pattern of asymptotic growth. Terminal size was reached at around age 4, and most of the growth occurred within the first 10% of the lifespan, and approximately 85% of somatic size was attained within the first year. The mean maximum age fluctuated from 8 years in Belize to 37 years in Bermuda with a maximum longevity of 43 years in Bermuda (Mutz 2006).

A study by Choat and Robertson (2002) show the following maximum age estimates from different locations of this species' range:

Ascension Island - 37 years
San Blas, Panama - 16 years
Lee Stocking Island, Bahamas - 27 years

In upwelling areas in Isla Margarita, Venezuela, it achieves 320 mm (SL), very rapid non-asymptotic growth the same as A. chirurgus (Robertson et al. 2005b, Choat and Robertson 2002a).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). It appears to normally mature at ~ 13 cm (FL) (Reeson 1983). This species was observed to form late afternoon resident spawning aggregations of 6,000-7,000 individuals, possibly year-round, during a 12-21 day period centered between the full and new moon of each month off southwestern Puerto Rico. This species also pair spawns. The pair spawning male holds a benthic territory and develops an ephemeral 'white-faced' color phase (Domeier and Colin 1997).

The pelagic larval stage duration ranges from 46 to 57 days (B. Victor in Rocha et al. 2002), it then settles on reefs when 26.7 mm (Robertson 1992). After settlement, juveniles have a distinct yellow coloration. Juveniles occur primarily on the reef crest, spurs, and a transition zone between the reef crest and reef flat (Bell and Kramer 2000). A study by Lawson et al. (1999) showed that this species exhibits ontogenetic habitat shifts. Newly settled blue tangs occur in the reef crest and spurs and grooves, but larger juveniles are more common in the back reef, while adults are evenly distributed across zones.

Cleaning behaviour

At Fernando de Noronha Archipelago in the southwestern Atlantic, juveniles hold cleaning stations together with the Doctorfish (Acanthurus chirurgus) and Sergeant Major (Abudefduf saxatilis) and graze algae as well as pick molted skin and parasites from Green Turtles (Chelonia mydas). This behaviour is preceded by a characteristic inspection usually followed by feeding nips on the turtles' skin (head, limbs, and tail), as well as on the carapace. The most inspected and cleaned body parts are the flippers (Sazima et al. 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 40 m (Ref. 7345), usually 2 - 18 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blue tangs live primarily on hard-coral reefs. They can also be found near soft corals, rubble, seagrass beds, and algal beds. Young fish prefer areas with plenty of cover. Breeding individuals congregate at flat, sandy areas between patches of reef. They shelter in coral holes and crevices. Blue tangs can be found at depths of 2 to 40 meters.

Range depth: 2 to 40 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4779 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3451 samples.

Environmental ranges
  Depth range (m): 0 - 1025
  Temperature range (°C): 7.090 - 28.067
  Nitrate (umol/L): 0.024 - 21.935
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 3.594 - 5.131
  Phosphate (umol/l): 0.034 - 1.415
  Silicate (umol/l): 0.805 - 14.234

Graphical representation

Depth range (m): 0 - 1025

Temperature range (°C): 7.090 - 28.067

Nitrate (umol/L): 0.024 - 21.935

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 3.594 - 5.131

Phosphate (umol/l): 0.034 - 1.415

Silicate (umol/l): 0.805 - 14.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 40m.
From 2 to 40 meters.

Habitat: reef-associated. Inhabits coral reefs and inshore grassy and rocky areas. Forms schools. Mainly diurnal. Marketed fresh. Feeds entirely on algae (Ref. 5521).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs, inshore grassy or rocky areas. Mainly diurnal. Feeds entirely on algae (Ref. 5521). Herbivore (Ref. 33499, 57616). Cleaned by Pederson's cleaner shrimp (Periclimenes pedersoni), scarlet striped cleaner shrimp (Lysmata grabhami), goby Gobiosoma evelynae, hogfish (Bodianus rufus), and wrasse (Thalassoma trifasciatum) as observed on the coral reefs in Bonaire, Netherlands Antilles (Ref. 36810). Also cleaned by Thalassoma noronhanum observed at Fernando de Noronha Archipelago off northeastern Brazil (Ref. 36301), by Elacatinus figaro observed off the coast of São Paulo, southeastern Brazil (Ref. 40102), and by Pomacanthus paru observed at the reefs of the Abrolhos Archipelago, off eastern Brazil (Ref. 40094).Strong preference for red and green algae, with the rhodophytes comprising 93% of the food items examined (Ref. 55789). Roving herbivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Blue tangs are herbivorous as adults, feeding largely on filamentous algae. They avoid eating calcareous material, like corals, because they lack the gizzard-like stomach of other surgeonfishes. Acanthurus coeruleus individuals feed singly, in small groups, or in large aggregations numbering over 100. Large aggregations can and in these groups can ravish damselfish gardens on reefs. Blue tangs that live in smaller populations do more foraging in the water column. Blue tangs will also eat plankton.

Animal Foods: zooplankton

Plant Foods: algae; phytoplankton

Primary Diet: herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Blue tangs help keep algae populations under control, which prevents the overgrowth and suffocation of corals. Increases in algal density have greatly increased blue tang population size. Most blue tangs move within single reef habitats but they may also live on wider ranges around the reef.

Juveniles graze algae and pick molted skin and parasites from green turtles (Chelonia mydas) in cleaning stations with surgeonfish (Acanthurus chirurgus) and sergeant majors (Abudefduf vaigiensis).

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators include reef sharks, tunas, snappers, jacks, groupers, and barracudas. Juveniles may also be taken by trumpetfish. Pelagic eggs are commonly eaten by small bar jacks, yellowtail snappers, and the black durgon.

Because of their flattened shape and sharp caudal spines, it is difficult for predators to swallow blue tangs.

Defense from predators while grazing and spawning is also accomplished by schooling. Attacks are more often observed on solitary fish.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds entirely on algae
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Blue tangs use vision to communicate and to locate food. They may also use chemical cues and touch, but little is known about communication and perception channels in these fish.

Communication Channels: visual ; tactile

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Eggs take 24 hours to hatch. Upon hatching, the pelagic larvae are less than 2 mm in length. The young, called ""acronuri"", are transparent, silvery, and diamond-shaped. They begin to develop scales and dorsal and anal fins at 2 to 6 mm in length. The caudal spine appears when the larvae reach 13 mm in length. Older acronuri drift to nearshore areas where they meta morphose into juveniles, including losing their silver color, developing a more rounded profile, and developing an elongated snout.

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Thresher, R. 1984. Reproduction in Reef Fishes. Neptune City, NJ: T.F.H. Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Blue tangs live up to 12 to 15 years in the wild.

Range lifespan

Status: wild:
12 to 15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Blue tangs generally mate in large resident aggregations over sandy patches between reefs. These fish seem to prefer locations 6 to 10 m deep with reasonably strong currents to sweep the fertilized eggs to sea. Mating readiness is indicated by color changes in the adults, who change from a uniform deep blue to pale blue on the front half of the body and dark blue on the rear half of the body. Courting females and a small number of males break off from the aggregation and release gametes at the water's surface in a behavior called a "spawning rush." Often, spawning rushes are not successful and are broken off by the female. Pair spawning is limited to small populations.

Mating System: polygynandrous (promiscuous)

Prior to a spawning aggregation, small groups of fish travel from nearby reefs before forming schools of over one-hundred individuals. Although spawning aggregations typically occur every day at a given location, they are often restricted to less than 20 individuals. The largest spawning occurs in the late afternoon three to eight days following the full moon in the winter months. However, the exact variables contributing to spawning aggregations are still unknown. It is likely that offshore currents, moon phase, predator abundance, and light levels all play a role in predicting spawning aggregations. Generally, spawning aggregation sites are also used by Acanthurus bahianus and members of the genera Scarus and Sparisoma. Sexual maturity is reached after one year.

Breeding interval: Breeding occurs once or twice a year.

Breeding season: Breeding occurs year-round, but more often during winter.

Average time to hatching: 24 hours.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protandrous ); sexual ; fertilization (External ); oviparous

Parental care is absent in this species.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Acanthurus coeruleus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Acanthurus coeruleus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTTTTTGGTGCTTGAGCTGGGATAGTAGGAACGGCCCTAAGCCTCCTAATCCGGGCAGAATTAAGCCAACCAGGCGCCCTCCTCGGAGATGATCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAATTGATTAATTCCACTAATAATTGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATAAGCTTTTGACTTTTACCACCATCTTTCCTGCTTCTACTTGCATCCTCTGCAGTAGAATCTGGTGCAGGCACAGGATGAACAGTATACCCCCCTCTAGCCGGTAATCTTGCACATGCAGGAGCATCCGTAGATCTCACTATTTTCTCCCTCCACCTAGCAGGGATTTCTTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCTATTTCCCAATATCAAACTCCCCTGTTTGTATGAGCAGTACTAATTACCGCCGTTCTACTCCTTCTCTCACTTCCTGTTCTCGCTGCTGGAATTACAATACTACTCACAGATCGAAACCTGAATACCACTTTCTTTGACCCAGCAGGTGGAGGAGACCCCATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Myers, R., Rocha, L.A., Abesamis, R., Clements, K.D., McIlwain, J., Nanola, C., Russell, B. & Stockwell, B.

Reviewer/s
Floeter, S., Edgar, G., Davidson, L. & Kulbicki, M.

Contributor/s

Justification
Acanthurus coeruleus is widely distributed in the Atlantic. It is common and abundant throughout its range. It is targeted in some areas and there have been localized declines from harvesting, however it is found in a number of marine reserves in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Acanthurus coeruleus is a secure species. It is not on the IUCN Red list.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Acanthurus coeruleus is rare in the Gulf of Mexico and is not common north of Florida. Acanthurus coeruleus was the most abundant species observed in traps from the U.S. Virgin Islands (Garrison et al. 2004). It is common and abundant throughout its range (L. Rocha pers. comm. 2010). There were order of magnitude differences in biomass among six Caribbean islands studied on which fishing pressure ranged from non existent in Bonaire, increasing through Saba, Puerto Rico, St. Lucia and Dominica and reaching very high intensities in Jamaica, with biomass declining as fishing intensity increased (Hawkins and Roberts 2004). Densities were recorded at (0.07 ind m-2) from Abrolhos Bank eastern Brazil. It showed higher densities within the no-take area of Timbebas (Francino-Filho et al. 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Acanthurus coeruleus is a targeted food fish in parts of its range. It is heavily fished in some areas (Haiti and Jamaica).

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; bait: occasionally; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Blue tangs can cause ciguaterra poisoning if eaten. Their sharp caudal spine can cause painful injuries if people try to handle them. Their sudden movements can cause the spine to create a deep wound, posing a risk of infection. Some species of Acanthurus may have venom associated with the spine as well.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Blue tangs are sometimes used as a bait fish. They are important in the aquarium trade, where they are popular fish. Blue tangs, and other reef fish, attract ecotourism in the form of snorkeling and diving.

Positive Impacts: pet trade ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus coeruleus

Acanthurus coeruleus is a surgeonfish found commonly in the Atlantic Ocean. It can grow up to 16 inches (41 cm) long. Common names include Atlantic blue tang, blue barber, blue doctor, blue doctorfish, blue tang, blue tang surgeonfish, yellow barber, and yellow doctorfish.[1]

Description[edit]

Although the body of the reef fish can vary in shade from light to dark blue, the dorsal, anal and caudal fins are golden blue. As juveniles, the edges on their dorsal and anal fins and the rings around their eyes are purple-blue, blue or blue-green. Their colors change during growth from a yellow juvenile, yellow tailed blue subadult and the blue adult phase.

Distribution[edit]

Acanthurus coeruleus is common off of Florida, the Bahamas, and other places in the Caribbean sea, including Bonaire. Blue Tangs are very common in Belize and especially Ambergris Caye. They are also common in the Gulf of Mexico. They are also found south to Brazil and north to New York and eat krill.

Behavior[edit]

Feeding[edit]

Blue tangs inhabit coral reefs and inshore grassy and rocky areas, where there is a high prevalence of algae. They are herbivorous, and their diet consists only of algae. They eat the algae from the reefs in which they reside, as well as off the bodies of surrounding fish. By eating the algae off of other fish, the blue tang serve as cleaners for them. [2] With the decline in the Diadema antillarum (sea urchin) population, the blue tang population increased since the algal resources that the two animals usually competed for were more abundant. [3]

Juvenile blue tangs eat continuously and feed heavily. This heavy feeding requirement is due to their poor utilization of food resources. The blue tang's stomach and intestinal lining are proficient at absorbing crushed cellular content, but are not very effective at processing cellulose. This digestive system inefficiency leads blue tangs to spend more time and resources on foraging on a very abundant and fast-growing food source in close proximity. This close proximity to an abundant food source allows for continuous foraging.[4]

Food Competition[edit]

Food distribution, density, and accessibility can determine population density and territory size in blue tangs. Territories with low biogenic structure are larger than those of higher biogenic structure. Since the algal food resources are less dense in low-biogenic structured areas, these territories would have to be larger in order to include the necessary amount of food. This is in accordance with the Ideal free distribution model.[5] This model states that competitors should adjust their distribution in accordance with habitat quality such that each individual will gain the same amount of resources.[6]

According to this model, there should be a lower density of blue tangs on low-biogenic structured territories compared to higher-biogenic structured territories where there is a higher abundance of food. In both territories, each individual will receive similar amounts of resources due to competition. There is no significant difference in feeding rates of blue tangs on each type of territory, meaning that those in larger, uncolonized, and low density territories can match the resources of those in smaller high density territories.[7]

Cleaning Behavior[edit]

Blue tangs engage in cleaning behaviors with other fish as both cleaners and clients. In these interactions, cleaners removes parasites and other materials from the surface of the client. Clients benefit by having ectoparasites and damaged tissue removed from the outside of their body. Removal of unwanted organisms and tissue can lead to improved health maintenance.

Cleaner Interactions[edit]

Blue tangs act as cleaners by grazing algae as well as eating molted skin and parasites off of the client's flesh once the client comes to the cleaning station. The most common client in these interactions is the green turtle, in which the blue tang inspects the green turtle by nipping its head, limbs, tail, and carapace.[8]

Client Interactions[edit]

When acting as clients, blue tangs normally approach cleaning stations inhabited by cleaner gobies. The blue tang's flippers are the most inspected area. Cleaners must be careful because the spine on both sides of the caudal peduncle are sharp and can inflict painful wounds. [9]

When in the client role, blue tangs will pose as they enter the cleaning station. Posing occurs before the cleaners inspect the incoming client fish. Fish who pose while in cleaning stations have a higher chance of getting cleaned. Blue tangs almost exclusively pose through head stands.[10]

Wound Healing[edit]

Clients who are cleaned by blue tang benefit after suffering an injury. Blue tangs incur many minor injuries, but infection as a result of injuries rarely leads to death. Recovery rates from both minor and major injuries are very high in blue tangs. Injured blue tangs are found to spend more time in cleaning stations compared to those further along in the healing process. This indicates that cleaning plays an important role in the wound healing process. Cleaners pick at the wound and eat the dead tissue in the peripheral area.[11]

Social Modes[edit]

Blue tangs experience three different social modes: territorial, schooling, and wandering. Blue tangs in non-territorial modes form schools and wander, while territorial blue tangs do not. Territoriality reduces competition for food resources because one individual claims both a territory and its resources. Additionally, schooling allows fish to better overcome food defense by others, and wandering allows for individual movement to feeding areas, cleaning stations, and other resources. Social behaviors are affected by outside conditions such as damselfish density, conspecific population density, and life history stage.[12]

Those in the territorial mode are aggressive and actively chase intruding blue tangs. They swim slower and feed more frequently than non-territorial blue tangs. Schooling fish form compact groups with other blue tangs in addition to other species. [13] Territorial blue tangs are found most often in the reef flat zone (sandy-bottomed with rocks or coral) and are rarely found in the spur zone (low coral ridges) or groove zone (sandy bottom channels). Territoriality prevalence decreases with increasing damselfish population, and the time of day also does not affect territoriality prevalence. [14]

Fish in schooling mode swim fast, eat at intermediate rates, and are not aggressive, even though they are often chased by damselfish.[15] Schooling is the most prevalent in areas with high damselfish densities such as the groove zone, spur zone, and crest zone (shallow reef area), while schools are most prevalent near midday.[16]

Blue tangs in the wandering mode keep to themselves and are not aggressive. They swim quickly and are often chased by other fish. Wandering blue tangs also visit cleaning stations more often than those in the other modes.[17] Wandering is found most often in the reef back zone (enclosed region with irregular patches of algae, rock and sand) and during the morning. With an increase in conspecific population density, blue tang individuals become more territorial. Small, juvenile blue tangs are territorial, but the incidence of territoriality in the larger classes decreases. However, in these fish, schooling and wandering increases.[18]

Juvenile Behavior[edit]

Juvenile blue tangs exhibit different behavior than both conspecific and congeneric adults. Juveniles are prevalent in the reef crest zone, spur zone, and on the fringe of the reef flat zone, but are rare inside of the reef flat zone. Juveniles remain solitary on their home ranges, and home range territory size increases with body size. These territories overlap with those of [Stegastes] damselfish. Juvenile blue tangs are aggressive in territory defense. They try to avoid stegastes, and are rarely chased by these damselfish.[19]

Relationship with humans[edit]

The fish is not under human threat.

The Atlantic Blue Tang is caught for commercial fishing, but maintains little importance to Caribbean industry. It is also used, though rarely, as bait.[20]

Value[edit]

The fish is at low value, giving off a pungent stench. Ciguatera poisoning may occur if the flesh is consumed. The adult fish's caudal spine is sharp, and is only out when the fish experiences excitement of some form. These fins can cut very deep into human skin and have been known to result in infections, mainly characterized by swelling and discoloration. Pain from such infections can last for long periods of time, sometimes for hours. Some species of the genus Acanthurus are even thought to possess poison glands on their caudal spines.[20]

References[edit]

  1. ^ Choat, J. H., et al. 2012. Acanthurus coeruleus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 June 2013.
  2. ^ Luna, Susan. "http://www.fishbase.org/summary/Acanthurus-coeruleus.html". FishBase. Retrieved 21 October 2013. 
  3. ^ Robertson, D. R. (1991). "Increases in surgeonfish populations after mass mortality of the sea urchinDiadema antillarum in Panamá indicate food limitation". Marine Biology 111 (3): 437–444. doi:10.1007/bf01319416. Retrieved 21 October 2013. 
  4. ^ Tilghman, G. Christopher; RuthEllen Klinger-Bowen; Ruth Francis-Floyd (2003). "Feeding Electivity Indices in Surgeonfish (Acanthuridae) of The Florida Keys". Aquarium Sciences and Conservation 3 (1-3): 215–223. Retrieved 21 October 2013. 
  5. ^ Semmens, Brice X.; Daniel R. Brumbaugh; Joshua A. Drew (September 2005). "Interpreting Space Use and Behavior of Blue Tang, Acanthurus coeruleus, in the Context of Habitat, Density, and Intra-specific Interactions". Environmental Biology of Fishes 1: 99–107. Retrieved 22 October 2013. 
  6. ^ West, Nicholas B. Davies, John R. Krebs, Stuart A. An introduction to behavioural ecology (4th ed. ed.). Oxford: Wiley-Blackwell. p. 119. ISBN 1405114169. 
  7. ^ Semmens, Brice X.; Daniel R. Brumbaugh; Joshua A. Drew (September 2005). "Interpreting Space Use and Behavior of Blue Tang, Acanthurus coeruleus, in the Context of Habitat, Density, and Intra-specific Interactions". Environmental Biology of Fishes 1: 99–107. Retrieved 22 October 2013. 
  8. ^ Luna, Susan. "http://www.fishbase.org/summary/Acanthurus-coeruleus.html". FishBase. Retrieved 21 October 2013. 
  9. ^ Luna, Susan. "http://www.fishbase.org/summary/Acanthurus-coeruleus.html". FishBase. Retrieved 21 October 2013. 
  10. ^ Cote, I. M.; Arnal, C.; Reynolds, J. D. (1 December 1998). "Variation in posing behaviour among fish species visiting cleaning stations". Journal of Fish Biology 53 (sa): 256–266. doi:10.1111/j.1095-8649.1998.tb01031.x. Retrieved 21 October 2013. 
  11. ^ Foster, Susan A. (December 1985). "Wound Healing: A Possible Role of Cleaning Stations". Copeia 4: 875–880. Retrieved 21 October 2013. 
  12. ^ Morgan, Ingrid E.; Donald M. Kramer (April 2005). "Determinants of social organization in a coral reef fish, the blue tang, Acanthurus coeruleus". Environmental Biology of Fishes 72 (4): 443–453. doi:10.1007/s10641-004-2861-1. Retrieved 21 October 2013. 
  13. ^ Morgan, Ingrid; Donald Kramer (November 2004). "The social organization of adult blue tangs, Acanthurus coeruleus, on a fringing reef, Barbados, West Indies". Environmental Biology of Fishes 71 (3): 261–273. doi:10.1007/s10641-004-0299-0. Retrieved 20 October 2013. 
  14. ^ Morgan, Ingrid E.; Donald M. Kramer (April 2005). "Determinants of social organization in a coral reef fish, the blue tang, Acanthurus coeruleus". Environmental Biology of Fishes 72 (4): 443–453. doi:10.1007/s10641-004-2861-1. Retrieved 21 October 2013. 
  15. ^ Morgan, Ingrid; Donald Kramer (November 2004). "The social organization of adult blue tangs, Acanthurus coeruleus, on a fringing reef, Barbados, West Indies". Environmental Biology of Fishes 71 (3): 261–273. doi:10.1007/s10641-004-0299-0. Retrieved 20 October 2013. 
  16. ^ Morgan, Ingrid E.; Donald M. Kramer (April 2005). "Determinants of social organization in a coral reef fish, the blue tang, Acanthurus coeruleus". Environmental Biology of Fishes 72 (4): 443–453. doi:10.1007/s10641-004-2861-1. Retrieved 21 October 2013. 
  17. ^ Morgan, Ingrid; Donald Kramer (November 2004). "The social organization of adult blue tangs, Acanthurus coeruleus, on a fringing reef, Barbados, West Indies". Environmental Biology of Fishes 71 (3): 261–273. doi:10.1007/s10641-004-0299-0. Retrieved 20 October 2013. 
  18. ^ Morgan, Ingrid E.; Donald M. Kramer (April 2005). "Determinants of social organization in a coral reef fish, the blue tang, Acanthurus coeruleus". Environmental Biology of Fishes 72 (4): 443–453. doi:10.1007/s10641-004-2861-1. Retrieved 21 October 2013. 
  19. ^ Bell, Thomas; Donald L. Kramer (August 2000). "Environmental Biology of Fishes August 2000, Volume 58, Issue 4, pp 401-409 Territoriality and Habitat Use by Juvenile Blue Tangs, Acanthurus coeruleus". Environmental Biology of Fishes 58 (4): 401–409. Retrieved 22 October 2013. 
  20. ^ a b Cathleen Bester. "Blue Tang". Florida Museum of Natural History. Archived from the original on 7 May 2009. Retrieved April 17, 2009. 

Further reading[edit]

  • Humann, P. and N. Deloach. Reef Fish Identification: Florida, Caribbean, Bahamas. New World Publications Inc., Jacksonville. pp. 32-33.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!