Overview

Comprehensive Description

Biology

Inhabits shallow bottoms with coral or rocky formations (Ref. 13628). Usually occurs in groups of five or more individuals. Mainly diurnal species. Feeds on algae. The spine on both sides of the caudal peduncle may inflict painful wounds (Ref. 5217). Marketed fresh. Minimum depth reported from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Massachusetts, USA and Bermuda southward to the Gulf of Mexico (except in the northeast) and Brazil. Eastern Atlantic: Ascension and St. Helena islands (Ref. 7345) off Angola (Ref. 26938). A recent record from Seychelles is probably a locality error (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda southward to the Gulf of Mexico (except in the northeast) and Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western and central Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 23 - 26; Analspines: 3; Analsoft rays: 21 - 23
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 381 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

38.1 cm SL (male/unsexed; (Ref. 9761))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Caudal fin moderately emarginate (Ref. 13442). Head and body deep and compressed (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 40 m (Ref. 7345), usually 2 - 25 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits shallow bottoms with coral or rocky formations.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3788 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2585 samples.

Environmental ranges
  Depth range (m): 0 - 48
  Temperature range (°C): 23.534 - 28.503
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 4.285 - 4.773
  Phosphate (umol/l): 0.006 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 48

Temperature range (°C): 23.534 - 28.503

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 4.285 - 4.773

Phosphate (umol/l): 0.006 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 40m.
From 2 to 40 meters.

Habitat: reef-associated. Occurs on hard sustrates in shallow water. Occasionally found in slightly deeper water. Usually occurs in groups of five or more individuals. Mainly diurnal species. Feeds on algae. Frequently associated with the doctorfish (Ref. 9710). Marketed fresh.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits shallow bottoms with coral or rocky formations (Ref. 13628); may be seen cropping all day long on algae (Ref. 33). Usually occurs in groups of five or more individuals. Mainly diurnal species. Feeds on algae. Herbivore (Ref. 33499, 57616). Feeding rate decreases with temperature more rapidly than the mean metabolic rate of teleost fishes (Ref. 59304). The spine on both sides of the caudal peduncle may inflict painful wounds (Ref. 5217). Also cleaned by Pomacanthus paru observed at the reefs of the Abrolhos Archipelago, off eastern Brazil (Ref. 40094). Preferred for sand and chlorophytes and avoided phaeophytes (Ref. 55789).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus bahianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTTTAAGTCTTCTAATCCGAGCAGAATTAAGTCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGATTTGGAAATTGATTAATTCCACTAATGATTGGAGCCCCTGACATAGCATTTCCACGAATGAATAATATGAGCTTTTGACTCTTGCCGCCATCCTTCCTACTTCTACTTGCATCCTCTGCAGTAGAGTCTGGTGCTGGTACAGGATGAACAGTTTATCCCCCTTTAGCTGGWAATCTGGCACACGCAGGAGCATCYGTAGACCTGACTATTTTTTCCCTTCACCTTGCAGGTATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCCCCCGCTACTTCCCAATATCAAACCCCTCTATTTGTATGAGCAGTATTAATTACTGCTGTTTTACTTCTTCTCTCACTTCCTGTCCTTGCTGCTGGTATTACAATACTACTCACAGACCGAAATTTAAACACTACCTTCTTTGATCCGGCAGGCGGAGGAGATCCTATTCTGTATCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus bahianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; bait: occasionally; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ocean Surgeonfish

The Ocean Surgeonfish (Acanthurus bahianus) is a tropical fish known to live in reefs in the Atlantic Ocean. It is edible, and occasionally marketed fresh,[1] but more often they are used as bait or in the aquarium trade.

Description

Ocean Surgeonfish are known by their oval bodies with uniform color (Usually blue-gray to dark brown), the pale to dark marking around the eyes, and the light yellow is now found on their bodies. Most have blue or white markings on the dorsal fin, anal fin, and tail fins and pale bands can sometimes be seen at the base of their tails. They often swim in schools with other species such as the Atlantic blue tang surgeonfish. They have been recorded up to 38 cm in length (15 in). Ocean surgeonfish have a total of 9 spines on their Dorsal fins and between 23 and 26 soft rays. Their anal fins have only 3 spines and between 21 and 23 rays. Their caudal fins are roughly emarginate, and the surgeonfish's body and head are both deep and compressed.[2][3]

Distribution

Ocean Surgeonfish inhabit coral reefs, where they feed on algae.[4] They are fairly common in Florida, the Bahamas, the Caribbean Sea, and the Gulf of Mexico. They can be found north to Massachusetts and Bermuda and south to Brazil

References

  1. ^ Baensch, H.A. and H. Debelius, 1997. Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition.
  2. ^ Randall, J.E., 1996. Caribbean reef fishes. Third Edition - revised and enlarged. T.F.H. Publications, Inc. Ltd., Hong Kong. 3nd ed. 368 p.
  3. ^ Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  4. ^ Randall, J.E., 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847.
  • REEF FISH Identification FLORIDA CARIBBEAN BAHAMAS; Humann, Paul and Ned Deloach; New World Publications Inc., jacksonville, Fl; pp. 34–35
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!