Overview

Comprehensive Description

Biology

Adults are found in various reef habitats (Ref. 48636) especially in reef flats and tidepools (Ref. 90102) and in surf-swept reef margins. Also found in intertidal areas and is usually associated with coralline rock and coral reef lagoons (Ref. 13227). Eggs are hemispherical and covered with numerous sticky threads that anchor them in the algae on the nesting sites (Ref. 240). Larvae are planktonic which occur primarily in shallow, nearshore waters (Ref. 94114).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Japan (Ref. 76833), Ryukyu Islands to eastern Australia, including Mariana, Marshall, Samoan, and Phoenix islands (Kiribati), the Ouvéa Atoll in the Loyalty Islands, to American Samoa.
  • Fricke, R. 1994 Tripterygiid fishes of Australia, New Zealand and the southwest Pacific Ocean (Teleostei). Theses Zool. 24:1-585. (Ref. 13227)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 15 - 16; Dorsal soft rays (total): 9 - 10; Analspines: 1; Analsoft rays: 17 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

4.8 cm SL (male/unsexed; (Ref. 54980))
  • Randall, J.E. 2005 Reef and shore fishes of the South Pacific. New Caledonia to Tahiti and the Pitcairn Islands. University of Hawaii Press, Honolulu, Hawaii. 720 p. (Ref. 54980)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 27 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Males have dark lower head and are abruptly dark posterior, occasionally with alternating broad dark and light bands (Ref. 37816 ). Adults are identified by the greenish tail and the color usually extends well onto the body (Ref. 48636). Mature males with two broad, black bands below third dorsal fin base and caudal peduncle, two bands joined ventrally; posterior half of anal fin black in mature males; caudal fin base white; pectoral and pelvic fins and body orange in mature males (Ref. 76833).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Neotype for Enneapterygius hemimelas Kner & Steindachner
Catalog Number: USNM 220068
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph; Radiograph
Collector(s): R. Wass
Year Collected: 1975
Locality: American Samoa: Tutuila Island, Fagasa Bay, Tutuila, American Samoa, Samoa Islands, Pacific
Depth (m): 3
  • Neotype: Fricke, R. 1994. Theses Zoologicae. 24: 221.; Kner, R. & Steindachner, F. 1866. Sitzungsberichte der Akademie der Wissenschaften in Wien. Mathematisch-Naturwissenschaftliche Klasse. 54 (pt 3): 371.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 30 m (Ref. 13227)
  • Fricke, R. 1994 Tripterygiid fishes of Australia, New Zealand and the southwest Pacific Ocean (Teleostei). Theses Zool. 24:1-585. (Ref. 13227)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 1 - 75
  Temperature range (°C): 25.075 - 28.798
  Nitrate (umol/L): 0.016 - 2.632
  Salinity (PPS): 33.821 - 35.550
  Oxygen (ml/l): 4.450 - 4.823
  Phosphate (umol/l): 0.092 - 0.270
  Silicate (umol/l): 0.829 - 7.618

Graphical representation

Depth range (m): 1 - 75

Temperature range (°C): 25.075 - 28.798

Nitrate (umol/L): 0.016 - 2.632

Salinity (PPS): 33.821 - 35.550

Oxygen (ml/l): 4.450 - 4.823

Phosphate (umol/l): 0.092 - 0.270

Silicate (umol/l): 0.829 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits surf-swept reef margins and lagoons.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Enneapterygius sp. 2AD

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius sp. 3AD

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Enneapterygius sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNTTATCTTCGGTGCATGAGCCGGTATAGTAGGCACAGCCCTCAGCCTTCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTTTAGGGGACGACCAAGTTTACAATGTAATTGTTACAGCCCATGCTTTTGTAATAATCTTCTTTATAGTAATACCCATTATGATTGGGGGCTTCGGTAACTGACTAATTCCTCTTATGATCGGTGCTCCCGACATGGCCTTCCCCCGAATGAACAATATGAGCTTTTGGCTTCTTCCCCCATCCTTCCTTCTCCTCCTAGCCTCTTCTGGTGTTGAAGCCGGAGCGGGGACAGGATGAACAGTTTACCCCCCTCTCTCAGGCAACCTCGCACACGCCGGGGCCTCTGTTGACCTAACTATCTTCTCCCTTCACTTAGCAGGGATCTCCTCCATCCTGGGTGCCATCAACTTTATCACTACAATTATTAATATGAAACCCCCAGCTATCTCACAGTACCAAACGCCTCTGTTCGTATGGGCTGTCCTAATTACTGCAGTTCTTCTGCTTCTCTCCCTTCCCGTTCTTGCTGCTGGCATTACTATGCTTCTTACAGACCGGAACCTCAATACTACCTTCTTTGACCCTGCAGGAGGGGGTGACCCGATTCTTTACCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius sp. 5AD

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius sp. 8AD

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius sp. 7AD

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Enneapterygius hemimelas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACCTAATCTTTGGTGCCTGAGCAGGCATGGTAGGAACAGCCTTAAGTCTCTTAATCCGGGCTGAACTAAGTCAGCCCGGCGCTCTTCTAGGCGACGACCAGATTTATAATGTAATTGTAACCGCCCATGCCTTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGTAATTGACTAATCCCCTTGATAATTGGTGCCCCCGACATAGCATTCCCTCGAATGAACAACATGAGCTTCTGGCTCTTGCCACCTTCTTTCCTTCTTCTGCTTGCTTCTTCTGGTGTAGAAGCAGGGGCCGGAACAGGGTGAACTGTATACCCCCCCCTATCTGGTAACCTCGCCCACGCCGGAGCCTCTGTTGACCTTACTATCTTCTCTTTACATCTCGCAGGTATTTCATCAATTTTAGGGGCAATTAATTTTATTACTACAATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACCCCTCTTTTTGTATGGGCCGTTCTAATTACAGCACTACTCCTTCTCCTCTCTCTCCCAGTACTAGCTGCTGGCATTACAATACTTCTAACAGATCGTAACCTTAACACCACCTTCTTTGACCCTGCATGCGGGGGGGATCCTATCCTCTATCAACATCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius hemimelas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enneapterygius cf. hemimelas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halfblack triplefin

The Halfblack triplefin (Enneapterygius hemimelas), also known as the Half-black triplefin, Blackbelly triplefin, or the Green-tail threefin,[2] is a species of triplefin blenny in the genus Enneapterygius.[3] It was originally described by R. Kner and F. Steindachner in 1867.[4] It is a non-migratory tropical blenny known from coral reefs in the western Pacific Ocean, and has been described from the Ryukyu Islands to eastern Australia.[3] It has been recorded swimming at a depth range of 0-30 metres (0-98.4 feet).[3][5]

The halfblack triplefin is described as a "relatively large" member of the Enneapterygius hemimelas species group.[6] Male halfblack triplefins can reach a maximum length of 4 centimetres (1.06 inches).[3][5]

References

  1. ^ a b c d e f g h Synonyms of Enneapterygius hemimelas at www.fishbase.org.
  2. ^ Common names for Enneapterygius hemimelas at www.fishbase.org.
  3. ^ a b c d Enneapterygius hemimelas at www.fishbase.org.
  4. ^ Kner, R. and F. Steindachner, 1867 [ref. 2640] Neue Fische aus dem Museum der Herren Joh. C. Godeffroy & Sohn in Hamburg. Sitzungsberichte der Kaiserlichen Akademie der Wissenschaften. Mathematisch-Naturwissenschaftliche Classe v. 54 (pt 3): 356-395, Pls. 1-5.
  5. ^ a b Enneapterygius hemimelas at www.fishwise.co.za.
  6. ^ Page 215, The Byerley Turk: The Incredible Story of the World's First Thoroughbred by Jeremy James. Stackpole Books, 2005. ISBN 0811701557/ISBN 9780811701556
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!