Overview

Comprehensive Description

Biology

Inshore and intertidal species found in estuaries and on tidal mudflats (Ref. 9859). Ascends brackish areas of rivers (Ref. 9859). Ovoviviparous (Ref. 50449). Biology little known (Ref. 9859). Flesh may be good to eat (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: tropical Australia, possibly more widely distributed. A nominal record from the Canary Islands may not be this species, but the sketchily known Pristis pristis from the eastern Atlantic is similar and needs comparison to determine if the two species are distinct.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Confirmed from tropical coastal and estuarine habitats in Northern and Northwestern Australia. Other records unconfirmed, but it may occur or have occurred more widely in adjacent Indo-Pacific areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

140 cm TL (male/unsexed; (Ref. 9859))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Greenish brown, rarely yellowish; white ventrally; fins paler. Body shark-like, pectoral fins distinct; head flattened, with a blade-like snout bearing 18-22 pairs of lateral teeth; blade broad, not tapering distally. Nostrils broad with large nasal flaps. Rostral teeth slender, with a groove along posterior margins; teeth reaching basal quarter of blade. Skin with denticles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; brackish; marine; depth range 0 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Coastal and estuarine habitats in tropical Australia, particularly over mudflats in the Gulf of Carpentaria (Pogonoski et al. 2002). It occurs some distance upriver, almost into freshwater (Last and Stevens 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pristis clavata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATTTAATTTTCGGTGCTTGAGCAGGAATGGTTGGTACTGGCTTAAGCTTGCTTATTCGAACAGAACTTAGTCAACCCGGAACACTTCTTGGAGACGATCAAATTTATAATGTAGTTGTAACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTAATACCGATCATGATCGGGGGCTTCGGTAATTGATTGGTTCCTCTGATGATTGGTGCTCCAGATATAGCATTCCCACGTATAAATAACATAAGCTTTTGATTGTTGCCTCCATCATTCCTCCTTTTATTAGCCTCTGCTGGTGTTGAAGCTGGTGCTGGGACAGGTTGAACTGTTTATCCCCCACTCGCTGGTAACCTTGCCCACGCTGGAGCATCTGTAGATTTAGCTATCTTTTCACTACATTTAGCTGGTATCTCCTCTATCTTAGCATCCATTAACTTCATTACAACAATTATCAATATAAAACCCCCAGCAATTTCTCAATACCAAACACCCTTGTTCGTATGATCCATTCTTGTAACAACCATCCTTCTTTTACTCTCACTACCAGTGTTAGCAGCAGGAATTACTATACTCCTCACAGACCGTAACCTAAACACAACCTTCTTCGATCCAGCTGGAGGAGGAGACCCAATCCTCTATCAACACTTAN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pristis clavata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bcd+3cd+4bcd

Version
3.1

Year Assessed
2006

Assessor/s
Cook, S.F., Compagno, L.J.V. & Last, P.R.

Reviewer/s
Valenti, S.V., Gibson, C. & participants of the regional Shark Specialist Group workshops (Shark Red List Authority)

Contributor/s

Justification
This relatively small sawfish may be restricted to the tropical coasts and estuaries of north and north-western Australia, or more widely distributed through the Indo-Pacific. Australian populations have declined significantly as a result of bycatch in commercial gillnet and trawl fisheries throughout this limited range and this bycatch continues, in commercial and recreational fisheries. If this sawfish also occurs outside Australian waters, these areas are fished even more intensively and populations there are likely to be nearing extirpation.

History
  • 2000
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information is available on range or populations outside Australia, but if this species occurs outside Australian waters, it is likely to be nearing extirpation there. Populations have been significantly reduced in Australia, as a result of bycatch in various commercial and recreational fisheries (Pogonoski et al. 2002). Fishing pressure continues and these declines are, therefore, also likely to continue.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2bcd+3cd+4bcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The principal threat to all sawfishes is fisheries, both targeted and bycatch, commercial and subsistence. Their morphology, particularly the long tooth-studded saw, makes them extraordinarily vulnerable to entanglement in any sort of net gear, including primitive fishing technology, and regardless of population size (which was probably always fairly small). When sawfish are taken in bycatch, they are often retained (particularly in areas where there is no legal protection) because of the very high value of their products. The meat of this species is likely to be good eating (Last and Stevens 1994). Pogonoski et al. (2002) noted that sawfish fins were valued at up to A$250/kg dried weight in Asian markets. Rostral saws can also be valuable in international trade, particularly for large specimens from other species). These species are also targeted opportunistically, for the same reasons.

This species is taken as bycatch in commercial and recreational fisheries (particularly gill nets and trawls, possibly also fish traps) throughout its limited confirmed range in northern and north-western Australia. Populations have been significantly reduced in this area, where sawfish have been identified as the species least likely to be subject to sustainable levels of bycatch (Stobutski et al. 2000). Bycatch of members of the family Pristidae (four or five Australian species, including P. clavata, combined) has been recorded in commercial catch and effort logbooks for a targeted shark fishery in northern Australia. Reported catches have declined steeply during the past decade (4,944 kg in 1994/95, 985 kg in 1995/96, 1,604 kg in 1996/97, 139 kg in 1997/98, 230 kg in 1998/99) (Pognoski et al. 2002, NTDPIF 2000).

There is increasing demand for live sawfish to put on display in public aquaria, with most exports for this purpose currently coming from Australia. The mortality rates associated with securing sawfishes for this use is unknown.

This species? known distribution could extend outside Australia, but these areas are far more intensively fished and it is, therefore, likely to be nearing extirpation elsewhere in the Indo-Pacific. In this case, the global population of this species will have declined to significantly less than 80% of its former levels 30 to 50 years ago. Even in Australia, where bycatch pressures are less acute, population declines are likely to continue, particularly in the absence of legal protection for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Pristis clavata was assessed as Endangered by the Australian Society for Fish Biology (ASFB) (Daley et al. 2002, Pognoski et al. 2000). This species possibly occurs within the Great Barrier Reef Marine Park and World Heritage Area, Queensland, towards the south-eastern edge of its range.

Pogonoski et al. 2002 recommended listing this species as a threatened species under Australia?s Commonwealth Environment Protection and Biodiversity Conservation Act (EPBC).

In January 2006, eBay announced it would ban the sale of sawfish parts and products on their on-line auction site. This measure will require vigilant monitoring within eBay with the help of outside experts.

All species of Pristidae have been listed under Appendix I of CITES (2007), except Pristis microdon which is listed under Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dwarf sawfish

The dwarf sawfish or Queensland sawfish, Pristis clavata, is a sawfish of the family Pristidae, found in tropical Australia. With a maximum length of approximately 1.4 metres (4.6 ft), this critically endangered species is by far the smallest species in its family.

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!