Overview

Comprehensive Description

Biology

A solitary species (Ref. 26340) found on nearly vertical cliffs and drop-offs beyond outer reefs. Often upside-down. Retreats into recesses when alarmed (Ref. 9710). Has been reared in captivity (Ref. 35420). Most common in water more than 30 m deep. Gradually replaces G. loreto at depths of 15-30 m (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Central Atlantic: West Indies including the Bahamas and Central America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Gramma melacara Bohlke & Randall
Catalog Number: USNM 199486
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Starck & H. Feddern
Year Collected: 1961
Locality: Bahamas: Little Bahama Bank; Grande Bahama Island, Edge of Drop-Off Off Settlement Point, Grand Bahama Island, Bahama Islands, Bahamas, Bahamian Archipelago, Atlantic
  • Paratype: Bohlke, J. E. & Randall, J. E. 1963. Proceedings of the Academy of Natural Sciences of Philadelphia. 115 (2): 43.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 10 - 180 m (Ref. 85755), usually 20 - 60 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 34
  Temperature range (°C): 26.770 - 26.770
  Nitrate (umol/L): 0.691 - 0.691
  Salinity (PPS): 36.481 - 36.481
  Oxygen (ml/l): 4.602 - 4.602
  Phosphate (umol/l): 0.051 - 0.051
  Silicate (umol/l): 2.028 - 2.028

Graphical representation

Depth range (m): 1 - 34
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 11 - 60m.
From 11 to 60 meters.

Habitat: reef-associated. Occurs on nearly vertical cliffs and drop-offs beyond outer reefs. Often upside-down. Retreats into recesses when alarmed (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gramma melacara

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTATTATTTGGTGCTTGAGCTGGTATAGTGGGGACTGCCCTAAGCCTGCTAATCCGAGCAGAACTGAGTCAACCCGGCTCCCTCTTGGGGGATGATCAAATTTATAATGTTATCGTTACGGCACACGCCTTCGTGATAATTTTCTTTATAGTTATACCTGTAATAATTGGAGGGTTTGGAAACTGATTAATTCCCTTAATAATTGGGGCCCCTGACATAGCCTTCCCCCGAATAAATAATATAAGCTTCTGGCTTCTCCCCCCATCCTTAATTCTCCTAATAACCTCTTCCGCAGTCGAAGCCGGTGCCGGCACCGGTTGAACTGTTTACCCCCCCTTATCTAGCAACCTAGCCCACTCTGGCGCATCCGTTGATCTCACAATTTTTTCCCTTCACCTAGCGGGTATTTCCTCTATCCTAGGGGCTATTAACTTTATTACCACTATTATTAACATAAAACCCTCGGCTACTACTTTATACCAAGTACCCCTTTTCGTTTGAGCCGTTTTAATTACAGCTGTGTTGCTTCTTCTATCATTACCCGTCCTTGCCGCGGGGATTACAATACTCCTAACTGACCGTAATCTTAATACCTCATTCTTCGACCCGGCAGGGGGGGGAGACCCAATCCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gramma melacara

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gramma melacara

Gramma melacara, the Blackcap Basslet, is a species of basslet inhabiting reefs in the tropical western Atlantic Ocean. This species prefers vertical surfaces with crevices in which it can hide. It can be found at depths of from 10 to 180 metres (33 to 590 ft) (usually between 20 and 60 metres (66 and 200 ft)). This species can also be found in the aquarium trade.[1]

Appearance[edit]

A small fish, reaching a length of 10 centimetres (3.9 in) TL, it is purple with a diagonal black cap on its head.

In the Aquarium[edit]

This hardy fish is typically peaceful and can be kept in a reef aquarium. Care should be taken however to only add one fish to an aquarium as they are territorial and do not accept other members of the same, or similar looking, species in the same aquarium. Small shrimp also may get eaten by this fish. Because this fish likes to hide, they should only be kept in an aquarium with large amounts of live rock. When these fish are frightened they hide in the rocks.

This fish can be kept in an aquarium that is 30 gallons or larger. If it is desired to keep more than one in an aquarium a tank that is at least 6 feet in length should be used and they should be added at the same time. The largest scientifcially measured Blackcap Gramma was 10.0 cm / 3.9 inches. The body colour varies from magenta to purple and there is a jet-black diagonal cap running from the lip to the foredorsal fin. It is not advisable to house the Blackcap Gramma in an aquarium smaller than 30 gallons / 115 litres. Include a lot of rocks, crevices and caves in the set up. Since this species is commonly found in deep waters, it is best to avoid sharp aquarium lights. The Blackcap Gramma is considered reef compatible and is commonly kept in reef aquariums. You should however keep in mind that it might devour really small invertebrates, such as copepods, amphipods and isopods. The Blackcap Gramma can start acting territorially towards other basslets, including members of its own species, once it has settled in an aquarium. The recommended water temperature for Blackcap Gramma is 72-78º F / 22-25.5º C. Keep the specific gravity at 1.020-1.025 and the pH-value between 8.1 and 8.4. The Blackcap Gramma is a carnivore species that needs to be kept on a meaty diet in the aquarium. It will normally accept dead food without much ado and you can for instance feed it mysid shrimp, fish flesh, crustacean flesh, and mixed frozen preparations suitable for marine carnivores. It may also eat devour really small invertebrates that lives in the aquarium, such as copepods, amphipods and isopods.

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Gramma melacara" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!