Overview

Comprehensive Description

Biology

Occurs usually in stagnant pools and ditches in clear to brown water (Ref. 56613). Found also in lowland swamps and paddy field. Bubble nest builder species (Ref. 57235). Eggs shrink to the bottom and were then collected by one or both parents and were embedded among the foam bubbles in the nest (Ref. 41595).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Known from the Malay Peninsula (Chumporn Province to Pattani and Satun) in southern Thailand and northern Malaysia. There is also a record from Singapore, which suggests a disjunct distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: Thailand, Malaysia, Singapore and Indonesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Malaysia and Indonesia; native to northern Sumatra.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 55 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.0 cm SL (male/unsexed; (Ref. 57235))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosed by having the following combination of characters: A bright red crescent on distal edge of caudal fin; absence of caudal transverse bars; dorsal transverse bars on distal two-thirds of dorsal fin; iridescent blue opercle scales; body dark brown to black; lateral scales 30-32; body depth 24.2-30.1% SL; dorsal-fin origin above lateral scales 15-17 (mode 16); length of dorsal-fin fin base 12.9-18.9% SL; and height of pectoral-fin origin 14.8-18.9% SL (Ref. 56613).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits marshlands, peat marsh, and water in shallow zones; adapted to paddy fields.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 6.0 - 7.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs shrink to the bottom and were then collected by one or both parents and were embedded among the foam bubbles in the nest (Ref. 41595).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Betta imbellis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGAGCCGGAATAGTCGGCACTGCTCTAAGTCTGCTTATTCGAGCAGAACTGAGCCAGCCCGGATCTCTTCTAGGAAATGATCAGATTTATAATGTAATTGTTACGGCACACGCTTTTGTAATAATTTTTTTCATAGTAATACCCATAATAATTGGGGGCTTTGGAAATTGACTTATCCCCCTAATGATTGGGGCCCCTGACATAGCCTTTCCCCGCATAAATAATATAAGTTTTTGGCTTCTTCCCCCCTCTTTCCTGCTTTTACTTACATCCGCTGGTGTGGAGGCCGGAGCAGGTACCGGATGAACCGTGTACCCTCCCTTATCTGGTAACTTAGCACACACGGGTGCATCAGTGGATTTGACAATCTTTTCACTACATTTAGCAGGTGTCTCATCCATTTTAGGTGCTATTAACTTTATTACCACAATCTTTAATATAAAACCCCCCGCAATAACCCAGTACCAAATACCTTTATTTGTATGAGCCGTATTAATTACTGCTTTCCTCCTCCTTTTATCCCTTCCTGTCTTGGCCGCAGGAATCACAATGCTACTAACAGATCGAAACCTAAATACAACTTTCTTTGACCCGGCTGGCGGGGGAGATCCAATCTTATATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Betta imbellis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Vidthayanon, C.

Reviewer/s
Ng, H.H. & Allen, D.

Contributor/s

Justification
The species is known from the Malay Peninsula in southern Thailand and northern Malaysia, and from Singapore. It can be found in both natural and agricultural habitats, but it is impacted by pollution and habitat loss and degradation. There is little information to suggest population decline across its range, and it is assessed as Least Concern at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Locally common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat degradation due to intensive agriculture is an ongoing threat. Genetic contamination (hybridisation) with Betta splendens occurred in some areas as a result of release from collections.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research is needed to confirm the species distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Peaceful betta

The peaceful betta or crescent betta, Betta imbellis, is native to Southeast Asia, where it occurs naturally in Thailand, Malaysia, and Indonesia, and has been introduced to Singapore. It is an inhabitant of stagnant waters in swamps, rice paddies, ditches, and pools. This species grows to a length of 6 cm (2.4 in). It is found in the aquarium trade.[2]

References[edit]

  1. ^ Vidthayanon, C. 2011. Betta imbellis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. <www.iucnredlist.org>. Downloaded on 22 March 2014.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2014). "Betta imbellis" in FishBase. February 2014 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!