Overview

Comprehensive Description

Biology

Adults occur in clear lagoon and seaward reefs, usually seen singly or in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Chromis alpha is distributed from north-western Australia, Christmas Island and the Cocos-Keeling Islands to Papua New Guinea, the Great Barrier Reef and New Caledonia, north to the Northern Mariana and Marshall Islands and east to French Polynesia. This species has also been recorded from the Spratly Islands (Thi and Quan 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Christmas Island in the eastern Indian Ocean to the Society Islands, north to Mariana Islands, south to New Caledonia; throughout Micronesia. Replaced by Chromis nigroanalis in the west Indian Ocean (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 11 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 85 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.5 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This fish is greenish to brown, the scale edges are darker, shading to blue ventrally. The scale centers on back often have small yellow spots. The edge of the opercle and preopercle are dark brown. The anal fin is blue.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Chromis alpha Randall
Catalog Number: USNM 223922
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & et al.
Year Collected: 1980
Locality: Ponape: SW Side, Ocean Side of Barrier Reef., Pohnpei, Micronesia, Caroline Islands, Pacific
Depth (m): 37
  • Paratype: Randall, J. E. 1988. Memoirs of the Museum of Victoria. 49 (1): 74, 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Chromis alpha Randall
Catalog Number: USNM 209903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & M. Gomon
Year Collected: 1973
Locality: Nusa Laut, North Shore At Tandjung Tala (Tolo)., Indonesia, Moluccas, Pacific
Depth (m): 2 to 12
  • Paratype: Randall, J. E. 1988. Memoirs of the Museum of Victoria. 49 (1): 74, 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Chromis alpha Randall
Catalog Number: USNM 273546
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Schroeder
Year Collected: 1979
Locality: Pagnagtaran Point, Sulu Sea, Puerto Princesa, Palawan, Philippines., Palawan, Philippines, Sulu Sea, Pacific
Depth (m): 6 to 12
  • Paratype: Randall, J. E. 1988. Memoirs of the Museum of Victoria. 49 (1): 74, 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Chromis alpha occurs on outer reef slopes of coral reefs at a depth range of 18 - 95 m. It is known to occur in loose aggregations.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 12 - 95 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 9 - 39.65
  Temperature range (°C): 28.764 - 28.798
  Nitrate (umol/L): 0.054 - 0.094
  Salinity (PPS): 34.260 - 34.644
  Oxygen (ml/l): 4.446 - 4.549
  Phosphate (umol/l): 0.166 - 0.187
  Silicate (umol/l): 1.094 - 1.374

Graphical representation

Depth range (m): 9 - 39.65

Temperature range (°C): 28.764 - 28.798

Nitrate (umol/L): 0.054 - 0.094

Salinity (PPS): 34.260 - 34.644

Oxygen (ml/l): 4.446 - 4.549

Phosphate (umol/l): 0.166 - 0.187

Silicate (umol/l): 1.094 - 1.374
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 12 - 95m.
From 12 to 95 meters.

Habitat: reef-associated. Aggregations found a few meters above steep outer reef slopes. Nests on small patches of loose sand (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chromis alpha

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCATTAAGCCTTCTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTCGGAGACGACCAAATTTACAACGTTATCGTTACGGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGCGGGTTCGGAAATTGACTTATCCCCCTTATGATCGGGGCCCCTGACATGGCATTTCCTCGAATAAATAATATGAGTTTCTGACTCTTGCCTCCCTCCTTCCTACTTCTGCTTGCCTCCTCTGGCGTTGAAGCAGGTGCAGGCACAGGATGAACTGTATACCCCCCTTTATCAGGAAACCTAGCACACGCGGGGGCCTCCGTAGACTTAACCATCTTCTCCCTCCACTTAGCCGGTATTTCCTCAATCCTGGGGGCTATCAACTTCATTACTACTATTATTAACATGAAACCCCCTGCTATCTCCCAGTATCAAACTCCTTTATTTGTGTGAGCTGTACTCATCACCGCTGTACTTCTCCTCTTATCTCTCCCAGTCTTAGCTGCTGGCATCACTATGCTCTTAACTGATCGCAACCTAAATACTACATTCTTCGACCCTGCAGGAGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chromis alpha

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chromis sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G.R.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Chromis alpha has been assessed as Least Concern owing to its broad distribution and abundance in the western Pacific. Although threatened by coral reef degradation in areas of its distribution, this is a localised threat and does not occur across its entire range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is abundant on outer reef slopes throughout its range. It is not unusual to observe hundreds of individuals during a single dive (G.R. Allen pers. comm. 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In localised patches of this species range, coral reef degradation and loss is occurring due to factors including water pollution, human population pressures, overfishing, tourism, Crown of Thorns starfish outbreaks and coral bleaching. This is a deep reef species with a broad geographic range so is unlikely to be undergoing significant declines as a result of these threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Chromis alpha, however its distribution coincides with a number of marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!