Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Anchovies grow to a maximum of 20 centimeters. Their back is blue-green; their flanks are gray with a silver-colored stripe. They eat zooplankton and algae. Anchovies reproduce in brackish water. They used to be found in massive amounts in the Zuiderzee and western Wadden Sea. The large schools were always accompanied by large numbers of porpoises. The species lost important spawning grounds when the Afsluitdijk (Causeway) was completed in 1932. Since around 1960, the anchovies have practically disappeared from the Wadden Sea. However, in 1993, this species was found spawning again in the Wadden Sea. This was an omen that they were returning, since they are being caught more often in the North Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Mainly a coastal marine species, forming large schools. Tolerates salinities of 5-41 ppt and in some areas, enters lagoons, estuaries and lakes, especially during spawning. Tends to move further north and into surface waters in summer, retreating and descending in winter. Feeds on planktonic organisms. Spawns from April to November with peaks usually in the warmest months. Eggs are ellipsoidal to oval, floating in the upper 50 m and hatching in 24-65 hours. Marketed fresh, dried, smoked, canned and frozen; made into fish meal (Ref. 9987).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Black Sea, British Isles, Dutch Exclusive Economic Zone, English Channel, European waters (ERMS scope), Greek Exclusive Economic Zone, Grevelingen, Israeli part of the Mediterranean Sea - Eastern Basin, Mauritius, Mozambique, Oosterschelde, Seychelles, Somalia, South Africa (country), Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Bergen, Norway to East London, South Africa (perhaps reaching Durban) (Ref. 10000). Also all of Mediterranean, Black and Azov seas, with stray individuals in Suez Canal and Gulf of Suez; also recorded from St. Helena (Ref. 189). Reported from Estonia (Ref. 33247).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Baltic Sea, North Sea, Mediterranean Sea, Black Sea, Azov Sea, eastern Atlantic: Norway to South Africa including Madeira and Canary Islands; Red Sea immigrant (Gulf of Suez); southwestern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 16 - 18; Analspines: 0; Analsoft rays: 13 - 15; Vertebrae: 46 - 47
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO.   http://www.fishbase.org/references/FBRefSummary.php?id=188 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm SL (male/unsexed; (Ref. 189)); max. reported age: 4 years (Ref. 92138)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout pointed; maxilla short, tip blunt, reaching almost to front border of pre-operculum, not projecting beyond tip of second supra-maxilla; tip of lower jaw reaching almost to below nostril. Gill rakers present on hind face of third epibranchial. Pseudobranch longer than eye, reaching onto inner face of operculum. A silver stripe along flank, disappearing with age.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO.   http://www.fishbase.org/references/FBRefSummary.php?id=188 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 400 m (Ref. 2683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6332 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3232 samples.

Environmental ranges
  Depth range (m): -9 - 313
  Temperature range (°C): 3.875 - 19.203
  Nitrate (umol/L): 0.926 - 14.675
  Salinity (PPS): 6.114 - 38.272
  Oxygen (ml/l): 2.113 - 8.019
  Phosphate (umol/l): 0.104 - 1.740
  Silicate (umol/l): 1.624 - 50.947

Graphical representation

Depth range (m): -9 - 313

Temperature range (°C): 3.875 - 19.203

Nitrate (umol/L): 0.926 - 14.675

Salinity (PPS): 6.114 - 38.272

Oxygen (ml/l): 2.113 - 8.019

Phosphate (umol/l): 0.104 - 1.740

Silicate (umol/l): 1.624 - 50.947
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 400m.
Recorded at 400 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Also recorded down to 400 m depth off West Africa and descending in winter to 100 to 159 m depth in the Mediterranean; euryhaline, tolerating salinities of 5 to 41 o/oo and in some areas entering lagoons, estuaries or lakes, especially in the warmer months during the spawning season. A tendency to extend into more northern waters in summer and generally to move into the surface layers, retreating and descending in winter (Ref. 189). 90% of the diet consisted of meso- and macrozooplankton (Ref. 42649).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Engraulis encrasicolus is prey of:
Conger conger
Aves

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Engraulis encrasicolus preys on:
Mysidacea
Copepoda

Based on studies in:
Portugal (Estuarine)

This list may not be complete but is based on published studies.
  • L. Saldanha, Estudio Ambiental do Estuario do Tejo, Publ. no. 5(4) (CNA/Tejo, Lisbon, 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Anisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawners. Gametogenesis is continuous, multiple spawning. Spawning peaks are usually in the warmer months which makes this species a spring-summer spawner. The limits of the spawning season is dependent on temperature and is therefore more restricted in northern areas. Sex ratio: 45% female (Ref. 5580).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Engraulis encrasicolus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCAACAAATCACAAAGACATTGGCACCCTATATCTTATTTTCGGTGCCTGAGCAGGAATGGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTTCTGGGGGAC---GATCAAATTTATAACGTAATCGTTACTGCTCACGCATTCGTAATAATCTTTTTCATGGTAATGCCCATTCTAATCGGTGGGTTCGGGAATTGACTAGTTCCTCTTATACTAGGGGCCCCAGACATGGCATTCCCCCGAATGAACAATATGAGCTTTTGACTCCTTCCTCCTTCTTTCCTTCTCCTCTTAGCATCATCTGGTGTTGAAGCAGGAGCCGGAACAGGATGAACAGTCTACCCCCCTTTATCAGGAAACCTTGCCCACGCAGGAGCGTCAGTAGATTTAACAATCTTCTCTCTCCACTTGGCAGGGATTTCATCAATCCTAGGTGCCATTAATTTCATTACTACTATTATTAATATGAAACCACCTGCTATTTCACAATACCAGACACCTCTATTTGTCTGAGCTGTATTAATCACGGCAGTACTTTTACTTCTTTCACTACCCGTTCTAGCTGCTGGGATTACTATGCTTCTTACAGACCGAAACCTAAATACTACTTTCTTCGACCCAGCAGGGGGAGGAGACCCGATTCTTTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTACATTCTTATTCTTCCTGGATTCGGGATGATTTCCCACATTGTAGCTTACTACGCCGGAAAAAAAGAACCTTTCGGGTATATGGGTATGGTCTGAGCTATGATGGCTATCGGACTACTAGGGTTCATTGTATGAGCCCACCACATGTTCACAGTAGGTATGGACGTAGATACTCGAGCATACTTCACATCTGCAACAATGATTATCGCCATCCCCACAGGAGTAAAAGTCTTTAGCTGACTCGCTACCCTACACGGGGGA---GCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Engraulis encrasicolus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 54
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; bait: usually; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European anchovy

The European anchovy (Engraulis encrasicolus) is a forage fish somewhat related to the herring. Anchovies are placed in the family Engraulidae.

It is easily distinguished by its deeply cleft mouth, the angle of the gape being behind the eyes. The pointed snout extends beyond the lower jaw. The fish resembles a sprat in having a forked tail and a single dorsal fin, but the body is round and slender. The maximum length is 8 1/8 in (205 mm).

Contents

Distribution

European anchovies are abundant in the Mediterranean and formerly also the Black and Azov seas (see below). They are regularly caught on the coasts of Abkhazia, Bulgaria, Croatia, France, Georgia, Greece, Italy, Romania, Russia, Spain, Turkey and Ukraine. The range of the species also extends along the Atlantic coast of Europe to the south of Norway. In winter it is common off Devon and Cornwall (United Kingdom), but has not hitherto been caught in such numbers as to be of commercial importance.

Zuiderzee and English Channel

Formerly they were caught in large numbers off the coast of the Netherlands in summer when they entered the Wadden Sea and Zuiderzee. After the closing of the Zuiderzee they were still found in the Wadden Sea until the 1960s. They were also caught in the estuary of the Scheldt.

There is reason to believe that anchovies at the western end of the English Channel in November and December migrate from the Zuiderzee and the Scheldt in the autumn, returning there the following spring. They were believed to be an isolated population, for none come from the south in summer to occupy the English Channel, though the species does exist off the coast of Portugal. The explanation appears to be that in summer, the shallow and landlocked waters of the Zuiderzee and the sea off the Dutch coast get warmer than the coastal waters off Britain, so anchovies can spawn and maintain their numbers in warmer Dutch waters better.

Dutch naturalists on the shores of the Zuiderzee first described their reproduction and development. Spawning takes place in June and July. The eggs are buoyant and transparent like most fish eggs, but are unusual in being sausage-shaped, instead of globular. They resemble sprat and pilchard eggs in having a segmented yolk and no oil globule. Larvæ hatch two or three days after fertilization, and are minute and transparent. In August young specimens, c. 1½ to 3½ in (40 to 90 mm) in length, are found in the Zuiderzee, and these must derive from the previous summer's spawning.

There is no evidence to decide the question whether all the young anchovies as well as the adults leave the Zuiderzee in autumn, but, considering the winter temperature there, it is probable that they do. Eggs have also been found in the Bay of Naples, near Marseilles, off the coast of the Netherlands, and once at least off the coast of Lancashire. The occurrence of anchovies in the English Channel has been carefully studied at the Marine Biological Association Laboratory in Plymouth. They were most abundant in 1889 and 1890. In the former year considerable numbers were taken off Dover in drift nets of small mesh used for the capture of sprats. In the following December large numbers were taken together with sprats at Torquay. In November 1890 a thousand of the fish were obtained in two days from the pilchard boats fishing near Plymouth; these were caught near the Eddystone.

Black Sea and Azov Sea

In areas around the Black Sea, the European anchovy is called gávros in Greek, hamsie in Romanian, ქაფშია (hamsia) or ქაფშა (hamsa) in Georgian, hamsi in Turkish, hapsi in Pontic dialect of Turkish, hapsia (a "biteful") in Pontic Greek, Hapchia in Laz,[1] хамсия (hamsiya) in Bulgarian, and хамса (hamsa) in Russian and Ukrainian. Its Ancient Greek name was ἀφύη, aphýē, later Latinized into apiuva, hence the standard Italian acciuga through the Genoese dialectal anciúa. Modern Greek also uses antsúya, a variant of the Genoese form, for processed -as opposed to the fresh "gávros"- anchovy products.

Black Sea adult anchovies can reach around 12–15 cm. In the summer, hamsi migrates north to warm shallow waters of the Azov Sea to feed and breed, returning to the deep for the winter by migrating through the Strait of Kerch. During migration the fish moves in huge schools, and are actively hunted by gulls and dolphins. Hamsi makes up a considerable part of fishing and fish processing industries, either canned or frozen. In Turkey, it is the staple food of the local Black sea cuisine,[2] widely used in pan dishes, baked goods, even as dessert. In Bulgaria hamsiya is traditionally fried and served in cheap fast-food restaurants along the shore, typically with beer. Since 1990s the dominant position of fried hamsiya is fading but still popular.

Anchovy populations in the Mediterranean were severely depleted in the 1980s by the invasive comb jelly Mnemiopsis leidyi which eats the eggs and young, they have since stabilized albeit at a much lower level.

Notes

  1. ^ Özhan Öztürk. Karadeniz Ansiklopedik Sözlük. 2005. pp. 486-488
  2. ^ Black Sea Region cuisine of Turkey

References

  • Froese, Rainer, and Daniel Pauly, eds. (2005). "Engraulis encrasicolus" in FishBase. 10 2005 version.
  • Kube, Sandra; Postel, Lutz; Honnef, Christopher & Augustin, Christina B. (2007): Mnemiopsis leidyi in the Baltic Sea – distribution and overwintering between autumn 2006 and spring 2007. Aquatic Invasions 2(2): 137-145.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!