Overview

Comprehensive Description

Biology

Inhabits seaward reefs below the surge zone, common near caves and ledges (Ref. 9710). Feeds mainly on crustaceans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Hawaiian Islands and Johnston Atoll.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Central Pacific: known only from the Hawaiian Islands and Johnston Atoll.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 14; Analspines: 4; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body with alternating about stripes of red and silvery white; head red; operculum with silvery reflections, a white streak from above edge of upper jaw to the corner of pre, and a narrow white band on posterior edge of preopercle. Five oblique scale rows on cheek; body depth 2.7-3.1 in SL; head length (HL) 2.55-2.75 in SL; snout length 3.85-4.15 in HL; interorbital width 4.8-5.15 in HL; maxilla extending from below front of the pupil nearly to center of the eye, upper jaw length 2.55-2.8 in HL; premaxillary groove at least to a vertical at front edge of the orbit; rounded anterior end of nasal; medial margin of nasal bone spineless; small nasal fossa without spinules on margin; slight ridge along the upper edge of suborbital bones smooth anteriorly, slightly serrate below posterior part of eye; preopercular spine, 5.4-7.1 in HL; 2 opercular spines (1 specimen with a large opercular spine), the lower 1/2 to 2/3 length of the upper spine; 4th dorsal spine usually longest, 2.2-2.55 in HL; 3rd anal spine 1.5-2.05 in HL (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 217m.
From 1 to 217 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 217 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 64 - 64
  Temperature range (°C): 23.741 - 23.741
  Nitrate (umol/L): 0.019 - 0.019
  Salinity (PPS): 35.173 - 35.173
  Oxygen (ml/l): 4.838 - 4.838
  Phosphate (umol/l): 0.135 - 0.135
  Silicate (umol/l): 1.423 - 1.423
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

At daytime, this holocentrid aggregates in crevices and under overhangs of basalt reefs in water deeper than 6 m, but especially below 20 m. It ranges out from its shelter into the surrounding areas after dark. Solitary individuals are active close to rock, coral, or pockets of sand. By first morning light it has returned to its daytime retreats (Ref. 13550).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron xantherythrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATTTAGTATTTGGTGCCTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATACGAGCTGAACTTAGCCAGCCCGGAGCCCTTCTGGGAGAC---GACCAGATTTATAATGTCATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGGAACTGATTAATTCCTTTAATGATCGGCGCCCCCGACATGGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTCCCTCCCTCATTCCTGCTTCTACTAGCTTCTTCCGGAGTTGAAGCTGGTGCCGGAACAGGATGAACGGTGTATCCACCCCTGGCAGGCAACCTAGCACACGCAGGAGCTTCTGTCGACCTAACTATCTTCTCACTTCACCTAGCAGGGATTTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATTATTAACATGAAACCTCCTGCCATTTCCCAATATCAAACACCTCTGTTTGTATGAGCTGTCCTAATTACAGCAGTACTTCTCCTTCTATCCCTACCCGTACTTGCAGCAGGCATTACTATGCTACTAACAGACCGAAACCTAAATACAACATTCTTCGACCCGGCAGGAGGTGGAGACCCAATTCTTTATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron xantherythrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sargocentron xantherythrum


Sargocentron xantherythrum[1] commonly known as Hawaiian squirrelfish or Striped Squirrelfish is a member of the Squirrelfish family that is endemic[2] to the Hawaiian islands. It occasionally makes its way into the aquarium trade. It grows to a length of 17 centimeters (6.7 in). [3]

Physical description[edit]

This fish has a red coloration with white stripes running along the body. It has sharp gill spines and rough scales that can cause the fish to be snagged in netting materials. [4]

Behavior[edit]

This is a nocturnal species that is much more active at night. It inhabits seaward reefs below the surge zone, and is common near caves and ledges. It feeds mainly on worms, crustaceans and starfish. [5] [6]


Notes[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!