Overview

Comprehensive Description

Biology

Feeds on worms, small insects, crustaceans and plant matter (Ref. 7020). Aquarium keeping: in groups of 5 or more individuals; minimum aquarium size 100 cm (Ref. 51150).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa: Middle Congo basin (Ref. 42032).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

P. interruptus is known from Pool Malebo (Stanley Pool) and from the Central Congo basin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 80 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 7020)); 6 cm (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; pH range: 6.0 - 8.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
P. interruptus is a benthopelagic species. It feeds on worms, small insects, crustaceans and plant matter (Mills and Vevers 1989). In a tank, after vigorous driving by the male, the female lays up to 300 eggs, sometimes more, which sink to the bottom. The eggs hatch after about 6 days (Mills and Vevers 1989).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on worms, small insects, crustaceans and plant matter.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

In tank, after vigorous driving by the male, the female lays up to 300 eggs, sometimes more, which sink to the bottom. Eggs hatch after about 6 days (Ref. 7020).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phenacogrammus interruptus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTTTCCACCAATCATAAAGATATTGGCACTCTCTACCTTGTATTTGGTGCCTGGGCCGGGATAGTAGGAACTGCCCTAAGTCTTTTAATTCGGGCAGAATTAAATCAACCCGGGTCCCTTCTAGGTGAC---GACCAGATTTATAATGTTATTGTTACAGCACATGCATTTGTAATAATTTTTTTTATGGTTATACCCATCATAATCGGGGGCTTCGGAAACTGACTCGTGCCTTTAATAATCGGGGCCCCTGACATAGCATTCCCTCGGATAAATAATATAAGCTTCTGACTTCTGCCCCCATCTTTCCTCCTTCTTTTAGCTTCCTCTGGGGTCGAAGCCGGGGCTGGAACAGGCTGAACAGTTTATCCCCCCCTCGCCGGCAATCTCGCCCACGCAGGGGCTTCTGTCGACTTAACTATCTTTTCGCTCCACCTCGCAGGGGTCTCCTCCATTCTTGGCGCAATTAACTTTATCACAACCATTATCAATATAAAACCTCCCGCCATTTCACAGTACCAAACCCCCCTATTTGTATGGGCTGTTCTTATTACAGCCGTCCTCTTACTTCTTTCTCTCCCCGTCTTAGCTGCAGGCATCACCATACTTCTCACAGACCGAAATTTAAACACCACCTTCTTTGACCCTGCCGGCGGAGGAGACCCAATCCTTTATCAACACTTATTCTGATTCTTTGGGCACCCTGAAGTATACATTTTAATCCTGCCAGGCTTTGGAATAATCTCTCATATTGTTGCTTACTACTCAGGGAAAAAAGAGCCATTTGGGTACATAGGCATAGTCTGGGCCATGATGGCAATTGGCCTACTAGGCTTTATTGTTTGAGCCCACCACATGTTTACAGTAGGCATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phenacogrammus interruptus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Snoeks, J., Laleye, P., Moelants, T. & Contreras-MacBeath, T.

Reviewer/s
Snoeks, J., Collen, B., Darwall, W.R.T., Ram, M., Smith, K. & Allen, D.

Contributor/s

Justification
P. interruptus has been assessed as Least Concern as it has a wide range, with no known major widespread threats.

History
  • 2007
    Least Concern
    (IUCN 2009.2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Currently, there is a lack of detailed population numbers and the global trend is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is collected commercially for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures or actions known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Congo tetra

The Congo tetra (Phenacogrammus interruptus) is a species fish in the African tetra family. It is found in the central Congo River Basin in Africa. It is commonly kept in aquaria.

Contents

Description [edit]

The Congo tetra has a typical full-bodied tetra shape with rather large scales. When mature, the iridescent colors of the Congo tetra run through the fish from front to back, starting with blue on top changing to red through the middle, to yellow-gold, and back to blue just above the belly. It is not its fluorescent colors that make this tetra so distinct, but rather its tail fin, which develops into a most beautiful grayish-violet feathery appendage with white edges. The males get up to 3.0 inches (8.5 cm). Females up to 2.75 inches (6 cm). The male is larger with more color, also the tail fin and dorsal fin are more extended.

Aquarium keeping [edit]

In the aquarium, mimic the natural habitat. The Congo tetra requires soft, peat-filtered water and a darker substrate. They are most comfortable in an aquarium with lower light levels. The beautiful rainbow colors of this fish will also show best in lower light levels. These fish are easily frightened by aggressive tank mates and loud noises and may wait for you to leave the aquarium before they will feed. It is a peaceful schooling fish and needs a large aquarium to thrive and develop its full beauty. Any aquarium of less than 30 gallons will not be suitable for a proper school of these fish. Hardness: 4-18 ° dGH Ph: 6.2 Temperature: (75-81 °F) 24-27 °C

Nutritions [edit]

Since they are omnivorous the Congo tetra will generally eat all kinds of live, fresh, and flake foods. To keep a good balance give them a high quality flake food every day. Feed brine shrimp (either live or frozen) or bloodworms as a treat.

Social behavior [edit]

They are generally a good community fish but they may try to bite smaller fish. Also, they may eat smaller plants. They sometimes like to nibble on softer plants and young shoots.

Breeding and reproduction [edit]

Congo tetras are egg layers. Some keys to breeding them are a large aquarium, peat-filtered water, and bright lighting to initiate spawning. They will lay up to 300 eggs that will drop to the bottom. The fry are large enough to eat freshly-hatched brine shrimp.

Conservation status [edit]

The IUCN lists the Congo tetra as a species of Least Concern.

See also [edit]

Sources [edit]

Author: Pecio, Anna Folia Biologica, Volume 57, Numbers 1-2, December 2008, pp. 13–21(9) Publisher: Institute of Systematics and Evolution of Animals, Polish Academy of Sciences

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!