Overview

Comprehensive Description

Sciades felis (Linnaeus, 1766)

Silurus felis ZBK Linnaeus, 1766: 503. Type locality: Charleston Harbor , South Carolina . U.S.A.Neotype : BMNH 1985.11.11.1 .

Arius milberti ZBK Valenciennes in Cuvier & Valenciennes, 1840b: 74. Type locality: New York; Charleston , South Carolina , U.S.A.Syntypes : MNHN B-0593 , New York .

Arius equestris ZBK Baird & Girard, 1854: 26. Type locality: Indianola , Texas , U.S.A..Holotype : USNM 636 .

Galeichthys guentheri ZBK Regan, 1907: 124, pl. 16 (fig. 1), 19 (fig. 3). Type locality: Gulf of Mexico . Syntypes : BMNH 1855.9.19.1105-1106 .

Distribution: Southeastern North America.

Countries: United States and Mexico.

Habitat: Marine and brackish waters, rarely in fresh waters.

Maximum size: 700 mm TL.

Material examined: AMNH 52073 (7 al, 240-288 mm TL) (1 c&s), U.S.A. , Alabama , Mobile, Dauphin Island and Vicinity ; AMNH 85099 (6 al, 82-91 mm TL), U.S.A. , Alabama , gulf of Mexico, Theodore Ship Channel ; FMNH 37916 (4 al, 184-206 mm TL), USA , South Carolina , Charleston Harbor .

  • Alexandre P. Marceniuk, Naércio A. Menezes (2007): Systematics of the family Ariidae (Ostariophysi, Siluriformes), with a redefinition of the genera. Zootaxa 1416, 1-126: 107-107, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:FFC65592-D8DB-41BE-AEAC-A41EAB6C6185
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults inhabit continental waters and enters estuaries. Found in turbid waters over muddy bottoms. Males incubate eggs in the mouth (Ref. 205). Commonly captured from catwalks, bridges and piers, particularly in passes and inland waterways. Edible, but generally not consumed (Ref. 7251).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Both marine (Ariidae) and freshwater catfishes (Ictaluridae) are notable for their unscaled skin, forked caudal fins, adipose fins set anterior to the caudal peduncle, and the presence of large, serrated spines positioned anteriorly to the dorsal fin and the pectoral fins. Marine catfishes are separated from Ictalurids based on the absence of barbels on the nostrils, and by body color, which is typically steel blue dorsally, fading to silver laterally, and white ventrally. Ariopsis felis, the sea catfish, is an elongate marine catfish that reaches 49.5 cm in length (Perret et al. 1971). The head is depressed in profile, with the mouth inferior. There are 3 pairs of barbels present. The maxillary barbels are nearly as long as the head, while the other 2 pairs are much shorter and set under the chin. The dorsal fin, anal fin and pectoral fins each bear a single strong spine. The dorsal fin has 7 soft rays, the anal fin has 19-20 rays and the pectoral fin has 6-10 rays. A pair of ventral fins is set far posterior to the origin of the dorsal fin. The adipose fin is black in color. The caudal fin and anal fins are generally tipped with black, while the remainder of the fins are dusky in color. Females have larger pelvic fins than males (Lee 1937; Merriman 1940; Muncy and Wingo 1983).
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Northern America to Yucatan, Mexico: Mexico and United States.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Northern America to Yucatan, Mexico: Mexico and United States.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts and northern Gulf of Mexico to southern Florida in USA and Mexico.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bagre marinus ranges from Cape Cod, Massachusetts south through coastal Florida and the Gulf of Mexico to the Yucatan Peninsula. They are much more common south of the Chesapeake Bay region (Muncy and Wingo 1983). Sea catfishes are common throughout the India River Lagoon and can be seasonally abundant.
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

70.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 5,500 g (Ref. 7251)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The maximum reported size of a sea catfish was 70.0 cm (27.6 inches) total length (TL), with a maximum reported weight of 5.5 kg (12.2 pounds) (IGFA 2001). The lifespan may be as long as 5 - 8 years (Benson 1982; Doermann et al. 1977).Age 0 sea catfishes in southwestern Florida were measured at 118 - 133 mm (4.6 - 5.2 inches) TL, while Age 1 sea catfishes grew to 193 mm (7.6 inches) TL (Gunter and Hall 1963).
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

4 chin barbels and a longitudinal groove in a depression on midline of head.
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 758 specimens in 1 taxon.
Water temperature and chemistry ranges based on 164 samples.

Environmental ranges
  Depth range (m): 0 - 158.5
  Temperature range (°C): 19.920 - 25.874
  Nitrate (umol/L): 0.289 - 3.253
  Salinity (PPS): 35.556 - 36.472
  Oxygen (ml/l): 4.106 - 4.855
  Phosphate (umol/l): 0.106 - 0.434
  Silicate (umol/l): 0.756 - 3.520

Graphical representation

Depth range (m): 0 - 158.5

Temperature range (°C): 19.920 - 25.874

Nitrate (umol/L): 0.289 - 3.253

Salinity (PPS): 35.556 - 36.472

Oxygen (ml/l): 4.106 - 4.855

Phosphate (umol/l): 0.106 - 0.434

Silicate (umol/l): 0.756 - 3.520
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds primarily on unidentified organic matter, secondarily on crustaceans, fishes, and blue crabs. Known to occur in salinities ranging from 0 to 37 ppt., temperatures ranging from 21.5 to 32 °C, and water transparency ranging from 0.3 to 2.1 m (Ref. 8980). See also Ref. 8981, 42268.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sea catfishes are opportunistic feeders that utilize mud and sand flats as feeding grounds. Algae, seagrasses, cnidarians, sea cucumbers, gastropods, polychaetes, shrimps, crabs, and smaller fishes comprise the bulk of the diet (Merriman 1940). Several authors have noted that blue crabs are a principal food source in the sea catfish diet (Gunter 1945; Gallaway and Strawn 1974). Males carrying eggs or juveniles do not feed (Muncy and Wingo 1983). However, juveniles under the protection of a male parent, feed on planktonic crustaceans that are within range of, or enter, the parent's mouth (Merriman 1940).Predators: Reported predators of sea catfishes are the longnose gar, bull shark, and large finfishes. Sea catfishes are also commonly caught as bait for large gamefishes such as the cobia (Muncy and Wingo 1983). Habitats: Benson (1982) reported that juvenile sea catfishes tend to remain in lower salinity estuaries and bays in Mississippi Sound. However, Reid (1957), working in Texas, and Pristas and Trent (1978), working in Florida, each reported that juvenile sea catfishes were most commonly collected in offshore trawl sampling, rarely collected while beach seining.
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Arius felis (Catfish and stingrays) is prey of:
Arius felis
Pomatomus saltatrix
Haliaeetus leucocephalus
Circus cyaneus
sediment POC

Based on studies in:
USA: Maryland, Chesapeake Bay (Estuarine)
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Abundance in gafftopsail catfishes are apparently related to bottom type and to water temperature, with higher abundances of gafftopsail catfishes noted when ample organic debris is present in substrate, and water temperatures are above 15 °C (Muncy and Wingo 1983). Activity Time: Gunter (1938) and Jones et al. (1978) reported that sea catfishes sometimes school nocturnally.
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Males carry the eggs in the mouth (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ariopsis felis reaches sexual maturity before the age of 2 (Benson 1982). Female size at maturity has been reported within the range of 12.6 - 26.5 cm (4.9 - 10.4 inches) (Merriman 1940; Benson 1962). In males, maturity is thought to occur at a somewhat larger size of approximately 25 cm (9.8 inches) in length (Merriman 1040). Females develop flap-like fatty tissue on their pelvic fins at maturity, and thus have larger pelvic fins than males of the species (Lee 1937; Merriman 1940). It has been proposed that the highly modified pelvic fins may be the site of fertilization and may play a role in transferring fertilized eggs to the mouth of the male for incubation (Gunter 1947). However, it is also possible that males pick up eggs from shallow depression in sand, as eggs, while adhesive, tend to be demersal.Ward (1957) examined eggs of females captured from Mississippi Sound. He noted eggs generally measured 6-8 mm in diameter in April, 9-14 mm in May, and 14-16 mm in June and July. Eggs were enriched with yolk by early June. Motile sperm occur in male Ariopsis felis from March - July in Mississippi Sound. Spawning occurs from May through August in shallow bays and estuarine waters, sometimes in less than 1 m (3.3 feet) of water (Muncy and Wingo 1983).
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Oval or elliptical eggs are large at fertilization, measuring 12-19 mm in diameter (Merriman 1940), are greenish in color, and develop in the mouth of the male parent. Parental care by males offsets low fecundity of females, which have only 20 - 65 eggs per spawning event. Numerous small, non-functioning eggs are often found attached to large, viable eggs. Gunter (1947) speculated that these smaller eggs might be utilized as a food source for males brooding offspring.Eggs of Ariopsis felis are brooded in the mouth of males and hatch after approximately 30 days when held under laboratory conditions at a temperature of 30 °C (86 °F) (Jones et al 1971). Larvae measure 29 - 45 mm (1.1 - 1.8 inches) TL at hatching and are retained in the mouths of male parents until their yolk sacs are absorbed approximately 2-4 weeks after hatching. Adult characteristics are present at absorption of the yolk sac but juveniles tend to remain with the parent, returning to its mouth for protection, for a short time thereafter.Juveniles measure 68-88 mm (2.7 - 3.5 inches) TL.
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ariopsis felis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTGTTAATTCGAGCTGAACTAGCCCAACCCGGTGCCCTCCTAGGCGAT---GACCAAATTTATAATGTTATTGTTACCGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGCTTTGGGAACTGACTTGTCCCCCTAATA---ATTGGAGCCCCCGACATAGCATTCCCTCGAATAAATAATATAAGCTTTTGGTTACTCCCTCCATCTTTCCTACTTCTCCTTGCCTCATCAGGAGTTGAAGCAGGAGCAGGAACAGGATGAACTGTTTACCCTCCTCTTGCTGGTAACCTCGCTCACGCAGGGGCCTCCGTAGACCTT---ACTATTTTTTCTCTTCACCTAGCAGGGGTATCATCAATTCTAGGGGCCATTAACTTTATCACAACTATTATTAACATGAAACCCCCAGCCATTTCACAATATCAAACACCCCTATTTGTTTGAGCCATTCTAATTACTGCTGTGCTCTTACTTCTTTCTCTCCCAGTTTTAGCTGCC---GGTATTACTATGCTACTAACAGACCGAAACCTAAATACTACTTTCTTTGATCCCGCAGGAGGAGGAGATCCAATTCTTTACCAACATCTCTTTTGATTCTTTGGCCACCCAGAAGTATATATCCTTATTTTACCAGGATTTGGGATAATTTCTCACATTGTAGCCTACTATTCAGGTAAAAAA---GAACCATTTGGCTACATAGGAATGGTATGAGCTATGATGGCTATTGGCCTTCTAGGCTTCATCGTATGGGCCCATCACATATTTACAGTAGGAATAGATGTAGACACCCGAGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ariopsis felis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Limited commercial and recreational importance.Fisheries Importance: COMMERICAL FISHERY: Though edible, the sea catfish is not generally consumed as a food fish, with many commercial and sport fishers regarding it as a nuisance species due to its dorsal and pectoral spines, which are large, serrated, and capable of causing painful wounds (Muncy and Wingo 1983). However, sea catfishes do have limited commercial importance and are harvested for industrial purposes in commercial bottom trawling operations (Muncy and Wingo 1983) and are taken recreationally for both bait and as food.From 1987 - 2001, 1.04 million pounds of marine catfishes (including both the sea catfish, Ariopsis felis, and Bagre marinus, the gafftopsail catfish) were harvested commercially in the 5-county area (Volusia, Brevard, Indian River, St. Lucie, Martin) encompassing the Indian River Lagoon. The harvest was valued at $777,497, which ranks marine catfishes thirty-fifth in dollar value to IRL counties, and forty-second in pounds harvested. Figure 1 below shows the dollar value of the commercial fishery of marine catfishes to IRL counties by year. As shown, the commercial catch ranged from a low of $9,167 in 1989 to a high of over $344,931 in 1992. Martin County accounted for the largest percentage of the marine catfish harvest with 32.8% in total (Figure 2), followed by St. Lucie County, which accounts for 21.5% of the total. Brevard, Volusia, and Indian River Counties accounted for 19.1%, 16.9% and 9.7% of the total respectively. Interestingly, the six-year period between 1990 - 1995 accounts for 87% of the total harvest of catfishes in the vicinity of the IRL. Of note is that 44% of the cumulative harvest for the entire period between 1987 - 2001 occurs in 1992, a clearly anomalous year. Martin County again accounts for the bulk of the harvest in 1992, however, the other 4 IRL Counties also saw greatly increased catches of catfishes in this year. RECREATIONAL FISHERY:Though the sea catfish is considered a nuisance species by many anglers, it is among the thirty most harvested species within the IRL region based on Marine Recreational Fisheries Statistics Survey information compiled by the National Marine Fisheries Service. From 1997 - 2001 IRL anglers captured 123,022 sea catfishes either for use as bait, or for food. Another 238,000 sea catfishes were harvested from other inshore waters, nearshore waters and offshore waters around the IRL. The bulk of the recreational harvest (35.7%), was taken in nearshore waters to the 3-mile state territorial limit. The IRL accounts for 34.1% of the harvest, while other inland waters, and offshore waters to the 200-mile federal limit account for 38.6% and 1.7% of the catch respectively.
  • Benson, N.G., ed. 1982. Life history requirements of selected finfish and shellfish in Mississippi Sound and adjacent areas. U.S. Fish and Wildlife Service, Office of Biological Services, Washington, D. C. FWS/OBS-81/51. 97 pp.
  • Doermann, J.E., D. Huddleston, D. Lipsey, and S.H. Thompson. 1977. Age and rate of growth of the sea catfish, Arius felis, in Mississippi coastal waters. J. Tenn. Acad. Sci. 52(4):148 pp.
  • Gallaway, B.J., and K. Strawn. 1974. Seasonal abundance and distribution of marine fisheries at a hot-water discharge in Galveston Bay, Texas. Contrib. Mar. Sci. 18:71-137.
  • Gunter, G. 1938. Seasonal variations in abundance of certain estuarine and marine fishes in Louisiana with particular reference to life histories. Ecol. Monogr. 8(3):313-346.
  • Gunter, G. 1947. Observations on breeding of the marine catfish, Gaelichthys felis (Linnaeus). Copeia 4:217-223.
  • Gunter, G., and G.E. Hall. 1963. Biological investigation of the St. Lucie estuary (Florida) in connection with Lake Okeechobee discharges through the St. Lucie Canal. Gulf Res. Rep. 1(5):189-307.
  • Harvey, E.J. 1972. Observations on the distribution of the sea catfish Arius felis larvae with and without chorion, with respect to salinity in the Biloxi Bay - Mississippi Sound Area. Miss. Acad. Sci. 17:77.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Jones, P.W., F.D. Martin, and J.D. Hardy, Jr. 1978. Development of fishes in the mid-Atlantic bight. An atlas of egg, larval, and juvenile stages. Acipenseridae through Ictaluridae. U.S. Fish and Wildlife Service. Biol. Serv. Program FWS/OBS-78/12. Vol . I : 301-307.
  • Lee, G. 1937. Oral gestation in the marine catfish, Galeichthys felis. Copeia:49-56.Merriman, D. 1940. Morphological and embryological studies on two species of marine catfish, Bagre marinus and Galeichthys felis. Zoologica 25(13):22i-248.
  • Muncy, R .J., and W.M. Wingo. 1983. Species profiles: life histories and environmental requirements of coastal invertebrates (Gulf of Mexico) - sea catfish and gafftopsail . U.S. Fish and Wildlife Service, Division of Biological Services, FWS/OBS-82/11.5. U.S. Army Corps of Engineers, TR EL-82-4. 17 pp.
  • Perret, W.S., B.B. Barrett, W.R. Latapie, J.F. Pollard, W.R. Mock, G.B. Adkins, W.J. Gaidry, and C.J. White. 1971. Cooperative Gulf of Mexico estuarine inventory and study, Louisiana. Phase I. Area description by Perret, W.S. Phase II. Biology p. 31-69. La. Wildl. Fish. Comm. 171 pp.
  • Pristas, P.J. and L. Trent. 1978. Seasonal abundance, size, and sex ratio of fishes caught in gill-nets in St. Andrew's Bay, Florida. Bull. Mar. Sci. 28(3):581-589.
  • Reid, G.K., A. Inglis, and H.D. Hoese. 1956. Summer foods of some fish species in East Bay, Texas. Southwest Nat. 1(3):100-104.
  • Snelson, F.F., Jr., T.J. Mulligan and S.E. Williams, 1984 Food habits, occurrence, and population structure of the bull shark, Carcharhinus leucas, in Florida coastal lagoons. Bull. Mar. sci. 34(1):71-80.
  • Swingle, H.A. 1971. Biology of Alabama estuarine areas - Cooperative Gulf of Mexico estuarine inventory. Ala. Mar. Resour. Bull. 5. 123 pp.
  • Swingle, H.A., and D.B. Bland. 1974. A study of the fishes of the coastal water courses of Alabama. Ala. Mar. Resour. Bull. 10:17-102.
  • Taylor, W.R. and N.A. Menezes, 1978 Ariidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome.
  • Wang, R.T., and J.A.C. Nicol. 1977. Effects of fuel oil on sea catfish: feeding activity and cardiac responses. Bull. Environ. Contam. Toxicol. 18(2): 170-176.
  • Ward, J.W. 1957. The reproduction and early development of the sea catfish, Galeichthys felis in the Biloxi (Mississippi) Bay. Copeia 4:295-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hardhead catfish

The hardhead catfish (Ariopsis felis) is a saltwater species of sea catfish similar to the gafftopsail catfish. It is one of thirteen species in the genus Ariopsis. The common name, hardhead catfish, is derived from the presence of a hard, bony plate extending rearward toward the dorsal fin from a line between the catfish's eyes.[1] It is an elongate marine catfish that reaches 19.5 in. (49.5 cm) in length. The average weight is under 1 pound, but they may reach up to 3 pounds. They are often a dirty gray color on top, with white undersides. The world record hardhead catfish is 3 pounds and 5 ounces.

Habits, distribution, and characteristics[edit]

Hardhead catfish are found mostly in the near shore waters of the Western Atlantic Ocean, around the southeast coast of the United States, around the Florida Keys and the coast of the Gulf of Mexico.[1][2] Hardhead catfish are also found in brackish estuaries and river mouths where the bottom is sandy or muddy.[3] It tends to move from shallower to deeper waters in the winter months.

The hardhead catfish has four barbels under the chin, with two more at the corners of the mouth.[4] These barbels help the catfish find crabs, fish and shrimp in the muddy bays where they live. The dorsal and pectoral fins each are supported by a sharp, slime-covered barbed spine. The dorsal spine is normally erect when the fish is excited and a tennis shoe or even a leather-soled shoe offers little protection. The gafftopsail catfish looks similar to the hardhead catfish, but its dorsal spine has a distinctive fleshy extension (like the fore-and-aft topsail of a ship).

Feeding Behavior[edit]

Ariopsis felis consumes a wide range of food. Hardhead catfish are opportunistic consumers that use mud and sand flats as hunting grounds.[5] They are also mainly secondary consumers, ingesting primarily detritus, meio-, and macrobenthic fauna and fish. Their diet primarily consists of algae, seagrasses, cnidarians, sea cucumbers, gastropods, polychaetes, shrimps, and crabs. They can occasionally be tertiary consumers.[5] Their diet depends on their size and location. Younger hardhead catfish tend to eat small crustaceans, like amphipods, shrimp, blue crabs, mollusks, and annelids.[6] Juveniles that are still under the protection of the male mouthbrooder will feed predominately on planktonic crustaceans close by to the mouth of the parent.[5] The adults primarily consume larger fish.[6]

Locomotion[edit]

Significant evidence suggests shows correlation between the fish's activity patterns and seasonal changes. Under controlled conditions of photoperiod, temperature, and water quality, hardhead catfish display non-random oscillations in angular orientation of locomotive activity. There appears to be annual, bimodal cycles for all three of the aforementioned variables. The cycles match with the seasonal inshore-offshore migrations of hardhead catfish. Photoperiod appears to be the exogenous cue that triggers the cyclic changes in behavior. The presence of this seasonal behavior indicates that there may exist a circadian neural mechanism in hardhead catfish.[7]

Communication[edit]

Chemical[edit]

Studies show that hardhead catfish respond to chemicals released by injured individuals with increased activity, illustrating communication amongst catfish. Their activity level was highest right after the onset of the chemical stimulus. In the studies, they also responded to chemical cues from injured sailfin mollies, but this response was weaker than that of the response from their own species. After examining the epidermis of the hardhead catfish, it appeared that the alarm substance cells were similar to those of freshwater catfish. Prior to this study, these chemical responses had only been seen in freshwater ostariophysans. Hardhead catfish are the first marine ostariophysans to elicit this type of alarm reaction.[8]

Echolocation[edit]

Furthermore, hardhead catfish are the first indicator that steichthyes possibly could use directional hearing to detect obstacles. Through observation, researchers noted that emissions of low-frequency sounds were related to the detection and avoidance of close by obstacles. Individuals within the group who produced sound avoided obstacles, whereas silent individuals crashed into obstacles frequently. Many fish have been associated with sound production for alarm, territorial, and courtship purposes, but sound probing of surroundings seems to be only be seen in hardhead catfish. So far, there is no evidence for far-field echolocation, such as seen in bats or toothed whales. The signal parameters have low frequency and amplitude, so it is unlikely that far-field reverberations would be useful. If echolocation exists, it is likely only useful in the near field by the catfish.[9]

Sound production[edit]

There is some evidence that sound production in hardhead catfish is differentiated both mechanistically and contextually. Mechanistically, sound can be produced in a different ways. There are thin bones by the swim bladder that can be vibrated by specialized sonic muscles. Also, grinding of the pharyngeal teeth and rubbing of the pectoral spines against the pectoral girdle can produce sound. These two mechanisms appear to be evolved fright responses by the hardhead catfish. Some argue that hardhead catfish use an unrefined form of sonar as a means of echolocation, which also implies some directional hearing ability. It is possible, but insofar unproven, that sound is used in courtship and spawning.[10]

Life Cycle and reproduction[edit]

The hardhead catfish has a reproductive season from around May to September.[11] Males and females reach sexual maturity before age 2.[5][11] Females at maturity are around 12.6-26.5 centimeters, and males are slightly larger, averaging around 25 centimeters. At maturity, females develop flap-like fatty tissue by their pelvic fins, which results in them having larger pelvic fins than males. It has been suggested that these enhanced pelvic fins are the site of fertilization and that they play a part in moving the fertilized eggs to the male mouthbrooder for incubation. Another possibility is that males pick up eggs from depressions in the sand, as eggs tend to be demersal.[5]

Parental Care[edit]

Mouthbrooding[edit]

Like other members of the family Ariidae, hardhead catfish are paternal mouthbrooders. After spawning, the male will carry the eggs in his mouth until they hatch. There are several non-functioning eggs within the brood that attach to the larger, viable eggs. It has been speculated that these non-functioning eggs are used as food for the male mouthbrooder, since mouthbrooders do not feed while they are taking care of the brood. .[5] Oral incubations continue through the yolk-sac larval state, for a total length of approximately 8–11 weeks.[12] Under laboratory conditions, offspring can hatch in roughly 30 days.[5] The offspring are roughly 6-8 centimeters long and slowly adapt to adult behavior, such as opportunistic bottom-feeding and scavenging.[12] At absorption of the yolk sac, juveniles begin to show adult characteristics.[5] The parental male can choose to carry the young after they have hatched until they are larger and capable of surviving on their own.[13]

Advantages[edit]

There are many advantages to mouthbrooding as opposed to other forms of parental care, such as bubblenesting. Mouthbreeders are able to freely move with the eggs in their mouth, and thus, can move as necessary to protect both himself and the brood. Even though mouthbrooding requires more energy by the male, there is also a greater chance of his young surviving to adulthood, and therefore, reproducing and continuing his genes; the eggs are not defenseless while in their father’s mouth.[14] Mouthbrooding by males counters the relatively low fecundity of females, who only have 20-65 eggs per spawning episode.[5] Finally, through breathing, the male is able to keep the brood well oxygenated, which also increases brood survival.[14]

Fishing[edit]

Hardhead catfish are voracious feeders and will bite on almost any natural bait. Hardhead catfish are also known to steal bait. Shrimp is a particularly effective bait to use. When fishing for this species in fresh water, assorted meats tend to work best as bait. For example: bacon, chicken, cuts of steak, and smaller fish. Hardhead catfish are generally regarded as an undesirable catch by most anglers, this may be largely due to the risk associated with handling the venomous fish as well as its 'fishy' taste as opposed to desirable game fish. A size 1 hook is usually effective for catching this fish. Anglers commonly use lightweight tackle if they are fishing specifically for this species, but many others use heavyweight tackle because the hardhead catfish seems to bite equally well on both. Care must be taken in handling hardhead catfish because the slime on their spines is mildly poisonous.[15] If the skin is punctured, pain and swelling will ensue, and infection may set in. The spine is barbed, which makes withdrawal an even more unpleasant process.

Hardhead catfish are edible but, like all catfish, require some effort to clean. It is one of the thirty most recreationally harvested species in the 5-county area (Volusia, Brevard, Indian River, St. Lucie, Martin) encompassing the Indian River Lagoon (IRL)in central Florida.[16] From 1997-2001, 361,022 hardhead catfish were harvested within 200 miles of the shore in the IRL region.

Hardhead are also harvested for industrial purposes in commercial bottom trawling operations. Annual harvests vary greatly, but from 1987–2001, 1.04 million pounds of marine catfishes (including both the hardhead catfish and the gafftopsail catfish) were harvested in the IRL region. The harvest was valued at $777,497.[17]

Weight and Length[edit]

Hardhead.png

Hardhead catfish weigh on average one pound and measure ten to twelve inches long.

As hardhead catfish grow longer, they increase in weight. The relationship between length and weight is not linear. The relationship between total length (L, in inches) and total weight (W, in pounds) for nearly all species of fish can be expressed by an equation of the form:

W = cL^b\!\,

Invariably, b is close to 3.0 for all species, and c is a constant that varies among species. The relationship described in this section suggests that a 20-inch hardhead catfish will weigh about 3 pounds, while a 25-inch hardhead catfish will likely weigh at least 6 pounds.

References[edit]

  1. ^ a b Webster, Pearse. Hardhead Catfish. South Carolina Department of Natural Resources. http://www.dnr.sc.gov/cwcs/pdf/Hardheadcatfish.pdf
  2. ^ Froese, R. and D. Pauly. Editors. 2009. FishBase. World Wide Web electronic publication. http://www.fishbase.org version (07/2009)
  3. ^ "Hardhead Catfish_ Arius felis". 
  4. ^ K. Hill, Smithsonian Marine Station 2005. http://www.sms.si.edu/IRLSpec/Ariops_felis.htm
  5. ^ a b c d e f g h i Hill, K. "Ariopsis felis". Smithsonian Marine Station at Fort Pierce. Retrieved 1 October 2013. 
  6. ^ a b Yáñez-Arancibia, Alejandro; Ana Laura Lara-Domínguez (30 November 1988). "Ecology of three sea catfishes (Ariidae) in a tropical coastal ecosystem-Southern Gulf of Mexico". Marine Ecology-Progress Series 49: 215–230. doi:10.3354/meps049215. 
  7. ^ Steele, Craig W. (June 1985). "Non-Random, Seasonal Oscillations in the Orientation and Locomotor Activity of Sea Catfish (Arius felis) in a Multiple-Choice Situation". Biological Bulletin 168 (3): 359–376. 
  8. ^ Smith, Michael E. (1 January 2000). Journal of Chemical Ecology 26 (7): 1635–1647. doi:10.1023/A:1005586812771. 
  9. ^ Schmidtke, Daniel; Jochen Schulz, Jörg Hartung, Karl-Heinz Esser (31 May 2013). "Structure and Possible Functions of Constant-Frequency Calls in Ariopsis seemanni (Osteichthyes, Ariidae)". PLoS ONE 8 (5). doi:10.1371/journal.pone.0064864. 
  10. ^ "Hardhead Sea Catfish". Discovery of Sound in the Sea. Retrieved 1 October 2013. 
  11. ^ a b Surge, Donna; Karen Jo Walker (22 November 2005). "Oxygen isotope composition of modern archaeological otoliths from the estuarine hardhead catfish (Ariopsis felis) and their potential to record low-latitude climate change". Palaeography, Palaeoclimatology, Palaeoecology 228 (1-2): 179–191. doi:10.1016/j.palaeo.2005.03.051. 
  12. ^ a b Avise, John C.; Carol A. Reeb; Nancy C. Saunders (September 1987). "Geographic Population Structure and Species Differences in Mitochondrial DNA of Mouthbrooding Marine Catfishes (Ariidae) and Demersal Spawning Toadfishes (Batrachoididae)". Evolution 41: 991–1002. doi:10.2307/2409187. 
  13. ^ Jones, P.W., F.D Martin, J.D. Hardy Jr. (1978). Development of fishes of the mid-Atlantic Bight: an atlas of egg, larval, and juvenile stages. Volume I: Acipenseridae through Ictaluridae. Ft. Collins, CO: U.S. Fish and Wildlife Service, Office of Biological Programs. 
  14. ^ a b Hellweg, Mike. "I've Got a New Mouthbrooding Betta-Now What?". Species Maintenance Program. Retrieved 2 October 2013. 
  15. ^ Texas Parks and Wildlife Department page on hardhead catfish http://www.tpwd.state.tx.us/huntwild/wild/species/hardhead/
  16. ^ k. Hill Smithsonian Marine Station 2005. http://www.sms.si.edu/IRLSpec/Ariops_felis.htm
  17. ^ K. Hill Smithsonian Marine Station http://www.sms.si.edu/IRLSpec/Ariops_felis.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!