Overview

Comprehensive Description

Biology

Found on rocky and sandy areas among kelp, in crevices, or kelp holdfasts (Ref. 48788).; subtidal (Ref. 51666).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific: northern California, U.S.A., to northern Baja California; near shore to 26 m in rocky areas among algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Central Pacific: Pacific Grove, California to Bahía San Quintín, Baja California Norte, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 38 - 43; Dorsal soft rays (total): 19 - 23; Analsoft rays: 44 - 49; Vertebrae: 65 - 70
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

17.1 cm SL (male/unsexed; (Ref. 48788))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

First dorsal spine associated with second pterygiophore; first anal pterygiophore equal in size to second; ventrolateral lateral line connected across breast in an arc that is bisected by a medio ventral lateral line extending from isthmus to fork about anus (Ref. 48788). Caudal fin rounded.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Esselenia carli Follett & Anderson
Catalog Number: USNM 296208
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. North, D. Leighton & J. Kawanui
Year Collected: 1961
Locality: California: San Diego, Off Bird Rock., California, United States, Pacific
Depth (m): 18 to 18
  • Paratype: Follett, W. I. & Anderson, M. 1990. Copeia. 1990 (1): 149.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 18 - 18
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 1 - 26 m (Ref. 48788)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 18 - 18
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Esselenichthys carli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCATGAGCCGGAATAGTAGGCACAGCTCTAAGCCTTCTTATTCGGGCAGAACTAAGCCAGCCCGGCGCCCTATTAGGGGATGACCAAATCTACAACGTAATTGTCACGGCACATGCGTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGGGGATTTGGGAACTGGCTTATCCCTCTAATGATCGGAGCCCCAGATATAGCATTTCCCCGAATGAACAACATGAGTTTTTGACTTCTCCCTCCTTCTTTCCTTCTCCTCCTTGCCTCTTCCGGGGTAGAGGCAGGGGCCGGGACAGGGTGAACCGTATACCCCCCTCTCTCTGGCAACTTGGCCCATGCGGGAGCGTCTGTTGATTTAACAATCTTTTCTCTTCACTTAGCAGGTATTTCTTCGATCCTTGGGGCAATCAATTTCATTACAACCATTATTAACATGAAACCCCCTGCCATCTCCCAATACCAGACACCCTTGTTTGTATGATCAGTACTTATTACTGCCGTCTTACTTCTTCTTTCCCTCCCCGTTCTAGCAGCTGGTATTACAATACTACTTACAGACCGAAATCTTAACACCACTTTCTTCGATCCCGCTGGAGGTGGAGATCCAATCCTTTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Esselenichthys carli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The former genus Esselenia preoccupied by Esselenia Hebard 1920 in grasshoppers; replaced by Esselenichthys Anderson 2003.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!