Overview

Comprehensive Description

Biology

Mainly inhabits coral and rocky reefs (Ref. 30573). Sometimes forms small aggregations around rocky outcrops and coral heads during daylight hours. Feeds on fishes and crustaceans (Ref. 30573).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Djibouti, Eritrea, Kenya, Mauritius, Mozambique, Red Sea, Seychelles, Somalia, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: Red Sea and East Africa to Sumatra. Occasionally found in Indonesia as far east as Ambon.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11 - 12; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 55))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Mainly inhabits coral reefs. Sometimes forms small aggregations around rocky outcrops and coral heads during daylight hours. Feeds mainly on fishes and crustaceans.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Snout somewhat pointed; preorbital bone relatively narrow, its width usually less than eye diameter. Preopercular notch and knob well developed. Scale rows on back rising obliquely above lateral line. Color is generally bright yellow on the upper half of the body and white ventrally; upper sides with four blue stripes, the uppermost extending from the upper edge of the opercle to the base of the last dorsal rays, and the lowermost from the rear edge of the eye to the middle of the caudal peduncle. The medial fins are yellow; the pectoral and pelvic fins whitish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 5.5 - 58
  Temperature range (°C): 25.775 - 26.151
  Nitrate (umol/L): 0.830 - 3.114
  Salinity (PPS): 35.062 - 36.032
  Oxygen (ml/l): 4.462 - 4.680
  Phosphate (umol/l): 0.240 - 0.546
  Silicate (umol/l): 3.653 - 4.277

Graphical representation

Depth range (m): 5.5 - 58

Temperature range (°C): 25.775 - 26.151

Nitrate (umol/L): 0.830 - 3.114

Salinity (PPS): 35.062 - 36.032

Oxygen (ml/l): 4.462 - 4.680

Phosphate (umol/l): 0.240 - 0.546

Silicate (umol/l): 3.653 - 4.277
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 30m.
From 10 to 30 meters.

Habitat: reef-associated. Collected by Phil Heemstra August 2000 at Sodwana. New record for South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 10 - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Sometimes form small aggregations around rocky outcrops and coral heads during daylight hours (Ref. 55).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus bengalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC7514-09|NC_011275|Lutjanus bengalensis| ACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTA---AGCCTGCTCATCCGAGCAGAACTAAGCCAACCAGGAGCCCTTCTTGGGGAC---GACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATCCCCTTAATG---ATCGGGGCCCCTGATATGGCATTCCCCCGAATAAACAACATGAGCTTTTGACTCCTTCCTCCATCATTTCTTCTACTCCTGGCCTCCTCAGGAGTAGAAGCAGGTGCTGGCACTGGATGGACAGTCTATCCTCCTCTAGCAGGAAACCTCGCGCACGCAGGAGCATCAGTTGATTTA---ACTATTTTTTCCCTACACCTGGCAGGTGTCTCTTCAATTCTAGGGGCCATTAACTTCATCACCACAATTATCAACATGAAACCCCCAGCTATTTCCCAATATCAAACACCACTATTCGTCTGAGCCGTTCTAATTACCGCTGTACTTCTTCTTCTCTCCCTTCCAGTCCTAGCTGCC---GGAATTACAATGCTTCTTACAGATCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGGGGAGGAGATCCCATCCTCTACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTATATATTTTAATTCTGCCCGGATTTGGGATGATTTCCCATATTGTTGCCTACTACTCTGGTAAAAAA---GAACCATTCGGCTATATGGGCATGGTTTGGGCTATAATAGCAATTGGCCTTCTAGGATTTATCGTATGAGCCCACCACATGTTTACAGTGGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus bengalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 26
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!