Overview
Comprehensive Description
Biology
Mainly inhabits coral and rocky reefs (Ref. 30573). Sometimes forms small aggregations around rocky outcrops and coral heads during daylight hours. Feeds on fishes and crustaceans (Ref. 30573).
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Distribution
Distribution
Djibouti, Eritrea, Kenya, Mauritius, Mozambique, Red Sea, Seychelles, Somalia, Tanzania
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Indian Ocean: Red Sea and East Africa to Sumatra. Occasionally found in Indonesia as far east as Ambon.
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Physical Description
Morphology
Dorsal spines (total): 11 - 12; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 8
-
Allen, G.R. and J.H. Talbot 1985 Review of the snappers of the genus Lutjanus (Pisces Lutjanidae) from the Indo-Pacific with the description of a new species. Indo-Pacific Fishes (11):87. (Ref. 469)
http://www.fishbase.org/references/FBRefSummary.php?id=469&speccode=150
Trusted
Size
Max. size
30.0 cm TL (male/unsexed; (Ref. 55))
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Diagnostic Description
Description
Mainly inhabits coral reefs. Sometimes forms small aggregations around rocky outcrops and coral heads during daylight hours. Feeds mainly on fishes and crustaceans.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Snout somewhat pointed; preorbital bone relatively narrow, its width usually less than eye diameter. Preopercular notch and knob well developed. Scale rows on back rising obliquely above lateral line. Color is generally bright yellow on the upper half of the body and white ventrally; upper sides with four blue stripes, the uppermost extending from the upper edge of the opercle to the base of the last dorsal rays, and the lowermost from the rear edge of the eye to the middle of the caudal peduncle. The medial fins are yellow; the pectoral and pelvic fins whitish.
-
Allen, G.R. and J.H. Talbot 1985 Review of the snappers of the genus Lutjanus (Pisces Lutjanidae) from the Indo-Pacific with the description of a new species. Indo-Pacific Fishes (11):87. (Ref. 469)
http://www.fishbase.org/references/FBRefSummary.php?id=469&speccode=150
Trusted
Ecology
Habitat
Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 5.5 - 58
Temperature range (°C): 25.775 - 26.151
Nitrate (umol/L): 0.830 - 3.114
Salinity (PPS): 35.062 - 36.032
Oxygen (ml/l): 4.462 - 4.680
Phosphate (umol/l): 0.240 - 0.546
Silicate (umol/l): 3.653 - 4.277
Graphical representation
Depth range (m): 5.5 - 58
Temperature range (°C): 25.775 - 26.151
Nitrate (umol/L): 0.830 - 3.114
Salinity (PPS): 35.062 - 36.032
Oxygen (ml/l): 4.462 - 4.680
Phosphate (umol/l): 0.240 - 0.546
Silicate (umol/l): 3.653 - 4.277
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 5.5 - 58
Temperature range (°C): 25.775 - 26.151
Nitrate (umol/L): 0.830 - 3.114
Salinity (PPS): 35.062 - 36.032
Oxygen (ml/l): 4.462 - 4.680
Phosphate (umol/l): 0.240 - 0.546
Silicate (umol/l): 3.653 - 4.277
Graphical representation
Depth range (m): 5.5 - 58
Temperature range (°C): 25.775 - 26.151
Nitrate (umol/L): 0.830 - 3.114
Salinity (PPS): 35.062 - 36.032
Oxygen (ml/l): 4.462 - 4.680
Phosphate (umol/l): 0.240 - 0.546
Silicate (umol/l): 3.653 - 4.277
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 10 - 30m.
From 10 to 30 meters.
Habitat: reef-associated. Collected by Phil Heemstra August 2000 at Sodwana. New record for South Africa.
From 10 to 30 meters.
Habitat: reef-associated. Collected by Phil Heemstra August 2000 at Sodwana. New record for South Africa.
Trusted
Environment
reef-associated; marine; depth range 10 - 30 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Trophic Strategy
Sometimes form small aggregations around rocky outcrops and coral heads during daylight hours (Ref. 55).
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lutjanus bengalensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC7514-09|NC_011275|Lutjanus bengalensis| ACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTA---AGCCTGCTCATCCGAGCAGAACTAAGCCAACCAGGAGCCCTTCTTGGGGAC---GACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATCCCCTTAATG---ATCGGGGCCCCTGATATGGCATTCCCCCGAATAAACAACATGAGCTTTTGACTCCTTCCTCCATCATTTCTTCTACTCCTGGCCTCCTCAGGAGTAGAAGCAGGTGCTGGCACTGGATGGACAGTCTATCCTCCTCTAGCAGGAAACCTCGCGCACGCAGGAGCATCAGTTGATTTA---ACTATTTTTTCCCTACACCTGGCAGGTGTCTCTTCAATTCTAGGGGCCATTAACTTCATCACCACAATTATCAACATGAAACCCCCAGCTATTTCCCAATATCAAACACCACTATTCGTCTGAGCCGTTCTAATTACCGCTGTACTTCTTCTTCTCTCCCTTCCAGTCCTAGCTGCC---GGAATTACAATGCTTCTTACAGATCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGGGGAGGAGATCCCATCCTCTACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTATATATTTTAATTCTGCCCGGATTTGGGATGATTTCCCATATTGTTGCCTACTACTCTGGTAAAAAA---GAACCATTCGGCTATATGGGCATGGTTTGGGCTATAATAGCAATTGGCCTTCTAGGATTTATCGTATGAGCCCACCACATGTTTACAGTGGGCATGG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Lutjanus bengalensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 26
Species With Barcodes: 1
Public Records: 5
Species: 26
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial
-
Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
http://www.fishbase.org/references/FBRefSummary.php?id=171&speccode=2534
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


