Overview

Comprehensive Description

Biology

More often in silty reef areas than in rich coral growth (Ref. 30573). Minimum depth reported taken from Ref. 9710.
  • Allen, G.R. 1985 Butterfly and angelfishes of the world. Vol. 2. 3rd edit. in English. Mergus Publishers, Melle, Germany. (Ref. 4858)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species has been recorded from the Arabian Peninsula including the Red Sea (around Eilat [Israel] and Jeddah [Saudi Arabia]), the Gulf of Oman (common near Muscat) and the Persian Gulf (Allen 1980, G.R. Allen pers. comm. 2006). It ranges as far south as Kenya on the East African coast (G.R. Allen pers. comm. 2006). It has been recorded at depths of between 4-50 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Red Sea, Persian Gulf and Gulf of Oman to at least 13°S (Ref. 10629). Mediterranean (Ref. 96519).
  • Randall, J.E. 1988 Pomacanthus rhomboides (Gilchrist and Thompson), the valid name for the South African angelfish previously known as Pomacanthus striatus. Spec. Publ. J.L.B. Smith Inst. Ichthyol. 46:7p. (Ref. 10629)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Western Indian Ocean: East Africa and Gulf of Aden to Persian Gulf (Arabian Gulf); Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 21; Analspines: 3; Analsoft rays: 19 - 20
  • Allen, G.R. 1985 Butterfly and angelfishes of the world. Vol. 2. 3rd edit. in English. Mergus Publishers, Melle, Germany. (Ref. 4858)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 500 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm SL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits coral reefs.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Usually found in coral-rich areas, rocky areas, and protected silty bays with coral.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 4 - 50 m (Ref. 30573)
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 3 - 55.5
  Temperature range (°C): 25.240 - 28.720
  Nitrate (umol/L): 0.004 - 0.862
  Salinity (PPS): 37.566 - 39.733
  Oxygen (ml/l): 4.314 - 4.482
  Phosphate (umol/l): 0.277 - 0.282
  Silicate (umol/l): 0.966 - 3.015

Graphical representation

Depth range (m): 3 - 55.5

Temperature range (°C): 25.240 - 28.720

Nitrate (umol/L): 0.004 - 0.862

Salinity (PPS): 37.566 - 39.733

Oxygen (ml/l): 4.314 - 4.482

Phosphate (umol/l): 0.277 - 0.282

Silicate (umol/l): 0.966 - 3.015
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 50m.
From 4 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus maculosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATTTACTATTTGGTGCCTGAGCCGGAATGGTAGGCACAGCTTTAAGCCTGCTAATCCGAGCCGAACTAAACCAACCAGGTAGCCTTCTCGGAGACGACCAGATCTATAATGTAATTGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTAATGCCAGCTATGATTGGAGGTTTCGGGAACTGATTGGTTCCACTGATAATTGGAGCCCCAGACATGGCATTCCCCCGAATAAACAATATAAGCTTTTGGCTCTTACCCCCTTCCCTCCTCCTCCTTCTTGCTTCCGCTGGAGTAGAAGCCGGAGCCGGAACTGGGTGAACAGTTTACCCGCCCCTAGCCGGTAATTTAGCCCATGCAGGAGCATCCGTAGACTTAACCATTTTCTCCCTCCATCTGGCCGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCTCCCGCTATCTCACAATACCAAACTCCACTGTTTGTGTGGGCCGTCCTGATTACTGCAGTATTACTTCTTCTCTCCCTCCCCGTCCTTGCCGCTGGCATTACTATGCTTCTCACAGACCGAAATTTAAACACTACTTTTTTCGACCCTGCAGGAGGCGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus maculosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
A common species with a relatively wide range and no apparent major threats. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection for the aquarium trade and subsistence fisheries is localized and do not seem to affect the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. Present within several marine protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
  • Wray, T. (ed.) 1979 Commercial fishes of Saudi Arabia. Ministry of Agriculture and Water Reseources, Kingdom of Saudi Arabia. White Fish Authority, United Kingdom. 120 p. (Ref. 9670)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pomacanthus maculosus

Pomacanthus maculosus is a marine angelfish distributed throughout the Persian Gulf, the northwestern Indian Ocean, and the Red Sea. Its common names include halfmoon angelfish, yellowband angelfish, yellowbar angelfish, yellow-blotch angelfish, and yellow-marked angelfish.[1] The species lives mainly in coral and rocky areas, in shallow to moderate depths (forty feet), though it is more often in silty reef areas than in rich coral growth. It occasionally makes its way into the aquarium trade.

Juveniles have different markings than adults.

Appearance[edit source | edit]

This angelfish grows to a size of 50 cm in length. It is very similar in appearance to the asfur angelfish (P. asfur), which is found in overlapping habitats in the Persian Gulf and Red Sea. The halfmoon angelfish can be distinguished from the asfur primarily by its tail color, which is pale to clear, while the asfur's tail is bright yellow.

As with other large angelfish in genus Pomacanthus, juveniles and sub-adults are differently marked and colored than adults. Small halfmoon angelfish are alternately blue, white, and black banded.

Diet[edit source | edit]

This species has a diet typical of angelfishes. Its main food is sponges. It also eats small anemones, algae, tubeworms, and shrimp.

Notes[edit source | edit]

  1. ^ Pyle, R., et al. 2010. Pomacanthus maculosus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 05 June 2013.

References[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!