Overview

Comprehensive Description

Biology

Inhabits coastal slopes, usually on barrel sponges in 10-30 meters depth (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Japan (Ref. 43239), Philippines (Ref. 48613), and Indonesia (Ref. 40966).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western central Pacific off Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

3.5 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 17 - 35 m (Ref. 40966)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 3 - 30
  Temperature range (°C): 28.662 - 28.662
  Nitrate (umol/L): 0.553 - 0.553
  Salinity (PPS): 32.276 - 32.276
  Oxygen (ml/l): 4.149 - 4.149
  Phosphate (umol/l): 0.380 - 0.380
  Silicate (umol/l): 6.058 - 6.058

Graphical representation

Depth range (m): 3 - 30
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurosicya labiata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAATAGTCGGAACGGCCTTAAGCCTTCTCATTCGAGCCGAACTCAGCCAACCTGGTGCCCTCCTCGGGGACGACCAGATCTATAATGTTATCGTCACCGCTCATGCATTTGTGATAATCTTCTTTATAGTGATACCAATTATGATTGGCGGATTCGGGAATTGACTAATTCCACTCATAATGGGGGCCCCGGACATGGCCTTCCCCCGAATAAACAATATGAGCTTCTGGCTCCTCCCCCCCTCTTTCTTGCTTCTACTAGCCTCCTCGGGCGTTGAAGCCGGAGCGGGTACAGGCTGAACCGTTTACCCGCCCCTAGCCGCTAATCTTGCCCACGCAGGAGCATCAGTCGACCTTACCATTTTCTCCCTCCATTTGGCAGGAGTATCCTCTATTCTAGGGGCAATTAACTTTATCACAACCATCCTCAACATAAAACCCCCCGCCATCTCCCAGTACCAAACGCCCCTGTTCGTCTGGGCCGTCCTAATCACAGCCGTCTTGCTTCTCCTATCCCTCCCGGTTCTCGCCGCAGGCATTACGATGCTTCTCACCGACCGTAACCTCAACACCACCTTCTTCGACCCTGCAGGTGGTGGAGACCCAATCCTTTACCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurosicya labiata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!