Overview

Comprehensive Description

Biology

A solitary species (Ref. 26340) occurring in coral reefs and rocky areas. It is considered an ambush predator that hides among the coral and sponges and is easy to approach. Frequents cleaning stations (Ref. 9710). The size versus sex distribution of Bermuda population indicates that this species is a protogynous hermaphrodite; all fish less than 37 cm TL were females and all fish larger than 45 cm TL were males (Ref. 6886). Randall (Ref. 33) reported food of 59 specimens 15 to 57 cm SL were purely fishes of a variety of species.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Western Atlantic: south Florida, Gulf of Mexico, Bahamas, Cuba, Haiti, Jamaica, Venezuela, and probably throughout the Caribbean to Brazil (FishBase 2003). The extent of occurrence and area of occupancy are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: southern Florida (USA) and the Gulf of Mexico to Brazil. It was suggested that Mycteroperca tigris was a transient species in the northwestern Gulf of Mexico, but has recently become abundant on the Flower Garden Banks off Texas (Ref. 6887).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 11
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1010 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

101 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 10,000 g (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by the following characteristics: Back crossed by about 11 pale narrow lines that slope downward and forward. No other grouper in the Caribbean has the same pattern of narrow pale diagonal lines (Ref. 26938). Further characterized by having depth of body contained 3.1-3.6 times in SL; head length 2.5-2.8 times in SL; flat interorbital area; rounded preopercle, without lobe at angle; diameter of posterior nostrils 3-5 times larger than anterior ones; large teeth, well developed canines (Ref. 89707).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occurs in coral reefs and rocky areas and is an ambush predator (FishBase 2003). Spawning aggregations of several hundreds of fish take place approximately one week following each full moon during the months of January to April at the east of Vieques Island, Puerto Rico (Sadovy et al. 1994).

Tiger Grouper becomes sexually mature female between 25-35 cm total length (Sadovy et al. 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 40m.
From 10 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 10 - 40 m (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 194 specimens in 1 taxon.
Water temperature and chemistry ranges based on 162 samples.

Environmental ranges
  Depth range (m): 0.7 - 22.5
  Temperature range (°C): 24.448 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 35.661 - 36.556
  Oxygen (ml/l): 4.313 - 4.773
  Phosphate (umol/l): 0.052 - 0.239
  Silicate (umol/l): 0.866 - 5.080

Graphical representation

Depth range (m): 0.7 - 22.5

Temperature range (°C): 24.448 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 35.661 - 36.556

Oxygen (ml/l): 4.313 - 4.773

Phosphate (umol/l): 0.052 - 0.239

Silicate (umol/l): 0.866 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cleaned by Pederson's cleaner shrimp (Periclimenes pedersoni), scarlet striped cleaner shrimp (Lysmata grabhami), goby (Gobiosoma evelynae and others), and hogfish (Bodianus rufus) as observed on the coral reefs in Bonaire, Netherlands Antilles (Ref. 36810).
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847. (Ref. 33)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mycteroperca tigris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTATTCGGTGCCTGAGCCGGCATAGTAGGGACAGCCCTCAGCCTACTAATCCGAGCTGAACTAAGCCAGCCAGGAGCCCTACTAGGCGACGATCAAATCTATAACGTAATTGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTCATCCCACTTATAATTGGCGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTCCTCCCCCCATCTTTCCTGCTCCTTCTCGCCTCTTCTGGCGTAGAAGCCGGGGCCGGTACCGGTTGGACGGTATACCCTCCCTTAGCTGGAAACTTAGCCCATGCAGGAGCATCTGTGGACTTAACCATTTTCTCCCTACATTTAGCAGGGATCTCATCAATTCTGGGAGCAATTAACTTTATCACAACCATTGTTAATATAAAACCCCCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGAGCTGTATTAATTACCGCAGTTCTTCTTCTCCTTTCTCTTCCTGTTCTTGCCGCGGGCATCACGATGCTACTTACAGATCGTAACCTTAATACCACTTTCTTTGACCCGGCCGGAGGAGGAGACCCAATCCTTTATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mycteroperca tigris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Garcia-Moliner, G. (Grouper & Wrasse Specialist Group)

Reviewer/s
Sadovy, Y. & Eklund, A.-M. (Grouper & Wrasse Red List Authority)

Contributor/s

Justification
Currently classified as Least Concern although landings data of Mycteroperca tigris from both areas in North America and Brazil are lacking. With the other data available, and considering the relatively wide distribution of this fish, its current population is not likely to be at great risk but the current taking of it from spawning aggregations is very likely to affect populations exploited in this way if this practice is not managed. Also, data from underwater visual census suggests possible declines of this species in the Greater and Lesser Antilles. More data should be sought to allow a more detailed evaluation of this species and the species should be re-evaluated as soon as possible. (Follow the link below to see further information on the regional status).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is not likely to be fragmented and population size cannot be deduced from data available. Minimum population doubling time is 4.5-14 years (FishBase 2003).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Overfishing and habitat destruction are the two most possible threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC) , IUCN Grouper and Wrasse Specialist Group
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
A tag-and-release project was initiated in 1996 to study spawning aggregation size and site fidelity (Matos and Posada 1998).

A series of conservation strategies for spawning aggregations in the Caribbean region is proposed. They include incorporation of known spawning aggregation sites into planning programs for Marine Protected Areas, development and implementation of monitoring and management programmes (Luckhurst 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Nigrelli, R.F. 1959 Longevity of fishes in captivity, with special reference to those kept in the New York Aquarium. p. 212-230. In G.E.W. Wolstehnolmen and M. O'Connor (eds.) Ciba Foundation Colloquium on Ageing: the life span of animals. Vol. 5., Churchill, London. (Ref. 273)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tiger grouper

The tiger grouper (Mycteroperca tigris) is a species of fish in the Serranidae family. This grouper has a tapered body, often reddish, with vertical stripes on its sides. It also may have, darker, dusky lines on the sides of its body. Young individuals have a yellow colour. This fish lives in sheltered reef areas. Growing up to 35 in (86 cm) long, the average weight is around 10 pounds. [1] Groupers are big robust predators that draw in food by sucking it into their mouths. They usually live in five to 20 feet of water. [2]

Location[edit]

It is found throughout the north-western Atlantic Ocean. Its natural habitats are open seas, shallow seas, subtidal aquatic beds, and coral reefs. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!