Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Zander resembles pike somewhat as far as outward appearance and behavior is concerned, but it is not related. Just like perch, it has two separate dorsal fins with the front one containing spines. Zanders can grow up to 120 centimeters in length. Sometimes there are large differences in length in the first year due to a lack of prey fish or because the prey fish are too large to eat. It is not unusual to have an entire year class no larger than ten centimeters while the young zanders that get sufficient food grow to 15-20 centimeters. Zander is very tasty and therefore intensely fished in the IJsselmeer.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Sander lucioperca (Linnaeus, 1758)

Inland water: 29400-865 (2 spc.), 28.10.1997 , Egirdir Lake , Isparta , M. Ôzulug ; 29400-620 (1 spc.), 26.01.1972 , Kuecuekcekmece Lagoon , Istanbul , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 44-44, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults inhabit large, turbid rivers and eutrophic lakes, brackish coastal lakes and estuaries. Feed mainly on gregarious, pelagic fishes. They attain first sexual maturity at 3-10 years of age, usually at 4. Undertake short spawning migrations. Individuals foraging in brackish water move to freshwater habitats. Migrations up to 250 km have been recorded. Homing is well developed, even nearby populations may be relatively isolated. Spawn in pairs at dawn or night. Spawning occurs in April-May, exceptional from late February until July, depending on latitude and altitude when temperatures reach 10-14° C on spawning grounds (Ref. 59043). Popularly fished by sport fishers. Its flesh is succulent (Ref. 30578). Utilized fresh or frozen and eaten steamed, broiled and microwaved (Ref. 9988). An individual weighing 19 kg was reportedly caught in 1959 in Starnberger, Bavaria, Germany (Peter Admicka, pers. Comm. E-mail: peter.adamicka@oeaw.ac.at). The Lake Hjälmaren Pikeperch Fish-Trap fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_1280.htm).
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Caspian, Baltic, Black and Aral Sea basins; Elbe (North Sea basin) and Maritza (Aegean Sea basin) drainages. North to about 65°N in Finland. Introductions began in 1878 in Great Britain, followed by Italy, Strymon drainage (Greece) and continental Europe west of Elbe, Ebro, Tagus and Jucar drainages in Iberian Peninsula, Onega and Severnaya Dvina in White Sea basin. Widely introduced outside Europe in Anatolia, North Africa, Ob and Amur drainages (Siberia), Lakes Issyk-kul (Kyrgyzstan), Balkhash and many smaller basins in central Kazakhstan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe and Asia: Caspian, Baltic, Black and Aral Sea basins; Elbe (North Sea basin) and Maritza (Aegean basin) drainages. North to about 65° N in Finland. Introduced widely (Ref. 59043). Several countries report adverse ecological impact after introduction (Ref. 1739).
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern and central Europe, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 20; Dorsal soft rays (total): 18 - 24; Anal spines: 2 - 3; Analsoft rays: 10 - 14; Vertebrae: 45 - 47
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm SL (male/unsexed; (Ref. 59043)); max. published weight: 20.0 kg (Ref. 40476); max. reported age: 17 years (Ref. 59043)
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished from congeners in Europe by the following combination of characters: 1-2 enlarged canine teeth in anterior part of each jaw; second dorsal fin with 18-22½ branched rays; and 80-97 scales on lateral line (Ref. 59043). Description: Long slender body, without cross-bars. No spines on the gill cover (Ref. 35388). Caudal fin with 17 soft rays (Ref. 40476).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Large, turbid rivers and eutrophic lakes; brackish coastal lakes and estuaries.

Biology:
Lives up to 17 years. Spawns for the first time at 3-10 years, usually at four. Spawns in April-May, exceptional from late February until July, depending on latitude and altitude, when temperatures reach 10-14°C in spawning grounds (lowest temperature for egg incubation 11.5°C). May undertake short spawning migrations. Individuals foraging in brackish water migrate to freshwater habitats (migrations of up to 250 km have been recorded). Homing well developed, even nearby populations may be relatively isolated. Males are territorial and excavate shallow depressions about 50 cm in diameter and 5-10 cm deep in sand or gravel, or among exposed plant roots on which eggs are deposited, usually in turbid water and at 1-3 m depth. Spawns in pairs, at dawn or night. Female remains over the nest while male circles rapidly around, at about 1 metre from nest. Then male takes a vertical orientation and both swim around swiftly, and eggs and sperm are released. After all the eggs are released female leaves the nest site. Male defends the nest and fans the eggs with his pectorals. Females spawn once a year. Feeding larvae are positively phototactic and feed on pelagic organisms after they leave the nest for open water. Piscivorous, feeding mostly on gregarious, pelagic fishes.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic; potamodromous (Ref. 51243); freshwater; brackish; depth range 2 - 30 m (Ref. 30578), usually 2 - 3 m (Ref. 27368)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2052 specimens in 1 taxon.
Water temperature and chemistry ranges based on 222 samples.

Environmental ranges
  Depth range (m): 3 - 70
  Temperature range (°C): 4.064 - 7.898
  Nitrate (umol/L): 1.194 - 2.178
  Salinity (PPS): 5.722 - 10.036
  Oxygen (ml/l): 7.360 - 8.684
  Phosphate (umol/l): 0.114 - 0.469
  Silicate (umol/l): 9.899 - 14.483

Graphical representation

Depth range (m): 3 - 70

Temperature range (°C): 4.064 - 7.898

Nitrate (umol/L): 1.194 - 2.178

Salinity (PPS): 5.722 - 10.036

Oxygen (ml/l): 7.360 - 8.684

Phosphate (umol/l): 0.114 - 0.469

Silicate (umol/l): 9.899 - 14.483
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Ontogenetic changes in its food composition are quite pronounced. Larvae measuring 6-8 mm consume small invertebrates. The consumption of fish is observed at an average length of 29 mm. Characteristically cannibalistic, particularly under conditions of an inadequate availability of other prey or under conditions of a large supply of their own young (Ref. 41405).
  • Bryazgunova, M.I. 1979 Feeding relationships of the young of the pike perch, Lucioperca lucioperca, the bream, Abramis brama, and fishes of lesser importance in the lower reaches of the Don. J. Ichthyol. 19(2):57-65.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The spawning places are over gravel in moving water (Ref. 205). "Males are territorial and excavate shallow depressions about 50 cm in diameter and 5-10 cm deep in sand or gravel, or among exposed plant roots on which eggs are deposited, usually in turbid water and at 1-3 m depth. Spawn in pairs, at dawn or night. The female remains over the nest while the male circles rapidly around, at about 1 meter from the nest. Then male takes a vertical orientation and both swim around swiftly, and eggs and sperm are released, The female leaves the nest after all eggs are released. The male defends the nest and fans the eggs with his pectorals. Females spawn once a year, laying all the eggs at one time (Ref. 88075). Feeding larvae are positively phototactic and feed on pelagic organisms after they leave the nest for open water" (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Stizostedion lucioperca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sander lucioperca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACTGCCCTAAGTCTACTTATCCGAGCGGAACTAAGCCAGCCCGGCGCTCTCCTTGGAGACGACCAAATTTACAACGTAATTGTTACGGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGTTTTGGGAACTGACTTATTCCACTTATGATCGGTGCCCCCGACATGGCATTTCCTCGAATAAATAACATAAGCTTTTGACTTTTACCCCCTTCTTTCCTACTTCTCCTTGCTTCCTCAGGGGTAGAAGCTGGGGCTGGTACAGGATGAACTGTCTACCCTCCCCTAGCAGGAAATTTAGCACATGCCGGGGCCTCTGTAGACTTAACCATTTTCTCTCTCCACTTAGCAGGAATTTCCTCAATTCTAGGCGCAATTAATTTTATTACAACTATTATTAACATGAAACCCCCTGCCATTTCTCAGTATCAGACACCTTTATTCGTATGAGCCGTATTAATTACCGCTGTCCTACTCCTACTTTCGCTCCCCGTACTTGCCGCCGGCATTACAATACTTCTTACAGACCGGAATCTAAATACCACATTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTCTATCAACATCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sander lucioperca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species with no known major widespread threats.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Zander

For other uses, see Zander (disambiguation).

Zander (Sander lucioperca, syn. Stizostedion lucioperca) is a species of fish from freshwater and brackish habitats in western Eurasia. It is closely related to perch. Zander are often called pike-perch as they resemble the pike with their elongated body and head, and the perch with their spiny dorsal fin. Zander are not, as is commonly believed, a pike and perch hybrid. In Europe, a second species (Sander volgensis) is limited to rivers in southern Russia and the basin of the Danube. These two species are suspected to hybridize occasionally where they are sympatric, as they produce fertile hybrids in captivity; no natural hybrids are known yet however, and while they are apparently hard to detect, it is suspected that the species are separated by strong prezygotic isolation. It strongly resembles, both in looks and in taste, the closely related American walleye (Sander vitreus).

The zander is a common and popular game fish in Europe. It is often eaten, and it may reach 20 kg (44 lb)[1] of weight, although typical catches are considerably smaller. Zander reach an average length of 40–80 cm (16-32 inches) with a maximum length of 120 cm (47.25 inches). Zander are not indigenous to the UK, but were introduced into the East Anglian fens (large, partly artificial waterways) in the 20th century and spread rapidly, after the release of 97 fingerlings to the Great Ouse Relief Channel in 1963 by the former Great Ouse River Board.[2] British Waterways included zander among a "dirty dozen" non-native species most likely to harm native wildlife along rivers in Great Britain.[3]

Their success in establishing themselves is owed to a number of factors, one of which is that they are particularly well adapted to life in the slow-flowing, sparsely vegetated, rather murky waters that comprise so many of the British lowland rivers.[4] Zander thrive in water with rather low visibility, unlike pike, which often dominate the predator fish niche in clear water. However, zander need plenty of oxygen and soon disappear from eutrophic areas.

Use by humans[edit]

Whole baked zander served in a restaurant in Balatonfüred, Hungary.

The zander is considered one of the most valuable food fishes native to Europe. It is esteemed for its light, firm but tender meat with few bones and a delicate flavour. Although it is not generally bred for food, its adaptability makes zander fishery quite sustainable. Indeed, in some regions release of young zanders is restricted, as natural stocks already provide a sufficient supply for the market, while boosting the population of this large predator would have an adverse effect on the zander's food fishes. Zander is especially well suited for fish fillets, sushi and sashimi. It can also be served whole, baked, smoked or cooked. In some culinary circles, zander is appreciated even higher than salmon. Even the offals can be cooked into consommé.

In 2004, it was revealed that some restaurants in the Minneapolis-St. Paul area of Minnesota in the United States were serving imported zander instead of the closely related North American walleye (the state fish, and a popular food in the region). While zander and walleye are almost indistinguishable by taste, the restaurants were selling the European fish under the name "walleye", which is an illegal practice. An investigation by the U.S. Food and Drug Administration followed.

In Poland, this fish is popular and regarded as a delicacy, but the difficulty in catching it makes it expensive. It is most commonly baked with a trace of butter.

In Finland, as a conservation measure, law regulates the minimum size of zander considered mature enough to be eaten. Zander is popular for its taste and its tendency to be picky with its prey, making it harder to catch than many other fish. Zander also tend to chase their prey before striking. When striking a fishing lure, it fights by pulling backwards, giving the impression that there is a big stone attached to the fishing line. Because zander is not as good in striking as pike, it prefers slower, even wounded fish; a lure moving too fast won't get the zander's attention. On the other hand, anecdotal evidence suggests that zander do not attack lures that are moving too slowly either.

In July 2009 in Switzerland, a zander attacked tourists in Lake Maggiore, sending two people to the emergency room; the worst cut inflicted was about 10 centimeters long. The 70-cm 8-kg fish was later caught by the local police who cooked it and offered it to the tourists for the trouble it caused.[5] It is very unusual for zander to attack humans.

References[edit]

  1. ^ "International Angling Rules" (IGFA) Accessed 19 November 2008)
  2. ^ anglin-guru.info
  3. ^ "Dirty dozen threaten waterways". BBC News. 14 August 2008. Retrieved 14 August 2008. 
  4. ^ "Foreign Fishes", The Living Countryside magazine (issue 36), p.706
  5. ^ "?" (in French). TV5. Retrieved 28 October 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!