Overview

Comprehensive Description

Biology

Occurs in very deep waters (Ref. 2850). Feeds on sea pens, crabs and mollusks (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Japan (Ref. 559) and the Bering Sea to off San Diego, California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 19 - 20; Analspines: 0; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 9,500 g (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Many small cirri scattered on head and body; no preopercular spine; branchiostegal membranes fused to isthmus; peritoneum pale (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Psychrolutes phrictus Stein & Bond
Catalog Number: USNM 216253
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Eagle
Year Collected: 1965
Locality: Pacific Ocean: 65 mi. Off Newport, Oregon, Oregon, United States, Pacific
Depth (m): 2800 to 2800
Vessel: Yaquina
  • Holotype: Stein, D. L. & Bond, C. E. 1978. Contributions in Science, Natural History Museum of Los Angeles County. No. 296: 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 500 - 2800 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 40 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 545.5 - 2800
  Temperature range (°C): 1.777 - 4.156
  Nitrate (umol/L): 37.755 - 44.916
  Salinity (PPS): 33.993 - 34.649
  Oxygen (ml/l): 0.523 - 2.352
  Phosphate (umol/l): 2.844 - 3.258
  Silicate (umol/l): 104.940 - 177.484

Graphical representation

Depth range (m): 545.5 - 2800

Temperature range (°C): 1.777 - 4.156

Nitrate (umol/L): 37.755 - 44.916

Salinity (PPS): 33.993 - 34.649

Oxygen (ml/l): 0.523 - 2.352

Phosphate (umol/l): 2.844 - 3.258

Silicate (umol/l): 104.940 - 177.484
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 800 - 2800m.
From 800 to 2800 meters.

Habitat: bathydemersal. Occurs in very deep waters. Feeds on sea pens, crabs and molluscs (Ref. 2850).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psychrolutes phrictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTAATTCGAGCTGAGCTAAGCCAACCCGGCGCCCTTTTAGGGGACGATCAAATTTACAATGTAATTGTTACAGCCCATGCTTTCGTAATGATTTTCTTTATAGTAATACCAATCATAATCGGGGGTTTTGGAAACTGACTAGTCCCCCTGATGATCGGAGCCCCCGACATAGCATTTCCTCGAATAAACAACATGAGCTTTTGACTTCTCCCACCCTCTTTTTTACTACTTCTCGCCTCTTCGGGGGTCGAAGCAGGGGCCGGAACCGGATGAACAGTCTACCCCCCTCTTGCTGGAAACCTGGCCCACGCAGGAGCCTCTGTCGATTTAACAATCTTCTCCTTACATTTAGCAGGAATTTCCTCAATTCTCGGAGCAATTAATTTTATTACAACTATCATTAACATGAAGCCCCCTGCTATCTCTCAGTATCAAACCCCTCTTTTCGTGTGGTCTGTCCTTATTACAGCCGTCCTACTACTGCTCGCCCTTCCAGTTCTTGCTGCCGGTATCACAATGCTTTTAACGGACCGAAACCTTAATACCACCTTTTTTGATCCAGCAGGGGGCGGAGACCCCATTCTTTATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Psychrolutes phrictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blob sculpin

The Blob Sculpin (Psychrolutes phrictus) is a species of deep-sea fish of the Psychrolutidae family. It feeds mainly on crustaceans, molluscs, and sea urchins.

It lives off the continental shelves in very deep water (839–2800 m) in the North Pacific ocean by the coasts of Japan, the Bering Sea, and California. When the female lays eggs the male guards them. Blob sculpin have spikes on their scales to protect them from enemies.[citation needed]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!