Overview

Comprehensive Description

Biology

Feeds mainly on pelagic forms (Ref. 1371). Too small for fresh consumption (Ref. 1371).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: northern Japan to Sea of Okhotsk, Bering Sea and south to Oregon, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific and Bering Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Analspines: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 560 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

66.0 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 550 g (Ref. 56476); max. reported age: 10 years (Ref. 56527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Snout short, blunt, with a broad spinous scute at its tip, its leading edge and most of its underside naked; suborbital shelf very narrow anteriorly; interopercle broadly rounded posteriorly; chin with very short barbel. Scales rather deciduous; body scales with 3 to 10 low, subparallel rows of spinules; gill and gular membranes and interopercle naked. Pyloric caeca short, 5 to 7. Overall color is grayish brown; fins blackish to dusky; oral and gill cavities blackish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Coryphaenoides cinereus
Catalog Number: USNM 48577
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1890
Locality: Unalaska To Kodiak: 695 Fms., Alaska, United States, Pacific
Depth (m): 1271 to 1271
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; non-migratory; marine; depth range 150 - 3500 m (Ref. 50550), usually 800 - 1200 m (Ref. 56476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 138 - 50000
  Temperature range (°C): 1.775 - 3.619
  Nitrate (umol/L): 26.814 - 45.612
  Salinity (PPS): 33.235 - 34.643
  Oxygen (ml/l): 0.482 - 5.858
  Phosphate (umol/l): 2.341 - 3.342
  Silicate (umol/l): 61.215 - 171.198

Graphical representation

Depth range (m): 138 - 50000

Temperature range (°C): 1.775 - 3.619

Nitrate (umol/L): 26.814 - 45.612

Salinity (PPS): 33.235 - 34.643

Oxygen (ml/l): 0.482 - 5.858

Phosphate (umol/l): 2.341 - 3.342

Silicate (umol/l): 61.215 - 171.198
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 225 - 2832m.
From 225 to 2832 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds mainly on pelagic forms (Ref. 1371).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coryphaenoides cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACTCTGTACCTAGTGTTTGGTGCCTGAGCCGGAATAGTGGGGACTGCTTTAAGTCTTCTTATCCGAGCCGAACTCAGCCAGCCTGGCGCACTCCTAGGCGACGATCAAATTTACAATGTTATTGTTACAGCGCACGCATTCGTAATAATTTTCTTTATAGTCATGCCTTTAATAATCGGAGGTTTCGGAAATTGACTCGTCCCCTTAATAATTGGCGCTCCTGACATGGCCTTTCCACGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCACTTCTGCTCCTTTTAGCATCTTCTGGTGTAGAAGCCGGAGCTGGAACCGGATGAACTGTTTACCCCCCTTTAGCCGGCAATCTTGCCCACGCAGGGGCATCCGTGGATTTAACAATTTTCTCTCTTCATCTGGCTGGTATTTCTTCAATTCTTGGAGCAATTAATTTTATTACTACCATTATTAATATAAAACCCCCAGCCATCACTCAGTACCAAACACCTTTATTTGTCTGATCCGTATTAATCACAGCAGTTCTCCTTTTACTCTCCCTCCCTGTGTTAGCAGCTGGGATTACAATACTCCTAACAGACCGAAATCTTAATACCTCCTTCTTCGACCCAGCTGGTGGAGGTGATCCCATTCTATACCAACATCTCTTCTGATTCTTCGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coryphaenoides cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!