Overview

Comprehensive Description

Biology

Feeds mainly on pelagic forms (Ref. 1371). Too small for fresh consumption (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: northern Japan to Sea of Okhotsk, Bering Sea and south to Oregon, USA.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific and Bering Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Analspines: 0
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 560 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

66.0 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 550 g (Ref. 56476); max. reported age: 10 years (Ref. 56527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout short, blunt, with a broad spinous scute at its tip, its leading edge and most of its underside naked; suborbital shelf very narrow anteriorly; interopercle broadly rounded posteriorly; chin with very short barbel. Scales rather deciduous; body scales with 3 to 10 low, subparallel rows of spinules; gill and gular membranes and interopercle naked. Pyloric caeca short, 5 to 7. Overall color is grayish brown; fins blackish to dusky; oral and gill cavities blackish.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Coryphaenoides cinereus
Catalog Number: USNM 48577
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1890
Locality: Unalaska To Kodiak: 695 Fms., Alaska, United States, Pacific
Depth (m): 1271 to 1271
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; non-migratory; marine; depth range 150 - 3500 m (Ref. 50550), usually 800 - 1200 m (Ref. 56476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 138 - 50000
  Temperature range (°C): 1.775 - 3.619
  Nitrate (umol/L): 26.814 - 45.612
  Salinity (PPS): 33.235 - 34.643
  Oxygen (ml/l): 0.482 - 5.858
  Phosphate (umol/l): 2.341 - 3.342
  Silicate (umol/l): 61.215 - 171.198

Graphical representation

Depth range (m): 138 - 50000

Temperature range (°C): 1.775 - 3.619

Nitrate (umol/L): 26.814 - 45.612

Salinity (PPS): 33.235 - 34.643

Oxygen (ml/l): 0.482 - 5.858

Phosphate (umol/l): 2.341 - 3.342

Silicate (umol/l): 61.215 - 171.198
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 225 - 2832m.
From 225 to 2832 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds mainly on pelagic forms (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coryphaenoides cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACTCTGTACCTAGTGTTTGGTGCCTGAGCCGGAATAGTGGGGACTGCTTTAAGTCTTCTTATCCGAGCCGAACTCAGCCAGCCTGGCGCACTCCTAGGCGACGATCAAATTTACAATGTTATTGTTACAGCGCACGCATTCGTAATAATTTTCTTTATAGTCATGCCTTTAATAATCGGAGGTTTCGGAAATTGACTCGTCCCCTTAATAATTGGCGCTCCTGACATGGCCTTTCCACGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCACTTCTGCTCCTTTTAGCATCTTCTGGTGTAGAAGCCGGAGCTGGAACCGGATGAACTGTTTACCCCCCTTTAGCCGGCAATCTTGCCCACGCAGGGGCATCCGTGGATTTAACAATTTTCTCTCTTCATCTGGCTGGTATTTCTTCAATTCTTGGAGCAATTAATTTTATTACTACCATTATTAATATAAAACCCCCAGCCATCACTCAGTACCAAACACCTTTATTTGTCTGATCCGTATTAATCACAGCAGTTCTCCTTTTACTCTCCCTCCCTGTGTTAGCAGCTGGGATTACAATACTCCTAACAGACCGAAATCTTAATACCTCCTTCTTCGACCCAGCTGGTGGAGGTGATCCCATTCTATACCAACATCTCTTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coryphaenoides cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!