Overview

Distribution

Northwest Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

36.0 cm TL (male/unsexed; (Ref. 56473)); max. published weight: 500 g (Ref. 56473); max. reported age: 8 years (Ref. 56473)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Limanda sakhalinensis
Catalog Number: USNM 75669
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Year Collected: 1906
Locality: (In Aniwa Bay approaching Koroskov, Saghalin Island)., Sakhalin Island, Russia, Aniwa Bay, Sea of Okhotsk, Pacific
Depth (m): 73
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Limanda sakhalinensis
Catalog Number: USNM 75674
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1906
Locality: (From Korsokov, Aniwa Bay, Saghalin Island, to East Bay, Cape Patience, eastern cost of Saghalin Island. In Aniwa Bay)., Sakhalin Island, Russia, Aniwa Bay, Sea of Okhotsk, Pacific
Depth (m): 79
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 10 - 360 m (Ref. 50550), usually 50 - 100 m (Ref. 56473)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 36 - 95
  Temperature range (°C): 0.395 - 0.986
  Nitrate (umol/L): 5.141 - 28.605
  Salinity (PPS): 32.522 - 33.357
  Oxygen (ml/l): 6.076 - 7.042
  Phosphate (umol/l): 1.116 - 2.437
  Silicate (umol/l): 17.775 - 65.120

Graphical representation

Depth range (m): 36 - 95

Temperature range (°C): 0.395 - 0.986

Nitrate (umol/L): 5.141 - 28.605

Salinity (PPS): 32.522 - 33.357

Oxygen (ml/l): 6.076 - 7.042

Phosphate (umol/l): 1.116 - 2.437

Silicate (umol/l): 17.775 - 65.120
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limanda sakhalinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGGTCTAAGTCTGCTCATTCGGGCAGAACTCAGCCAACCTGGGGCTCTCCTGGGAGACGATCAAATTTATAACGTGATCGTTACCGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGAGGGTTCGGAAACTGACTTATCCCACTAATGATCGGGGCCCCTGATATGGCGTTCCCTCGGATAAACAACATGAGTTTCTGACTCCTGCCCCCATCGTTTCTCCTCCTCCTAGCCTCTTCAGGCGTAGAAGCCGGGGCCGGAACTGGGTGAACAGTATATCCCCCTTTAGCTGGAAATCTAGCACATGCCGGAGCATCCGTAGACCTAACAATCTTCTCCCTTCACCTTGCGGGGATCTCATCAATCCTGGGGGCGATCAACTTTATCACCACAATCATCAACATGAAACCTACAGCAGTAACTATGTACCAAATCCCACTATTCGTGTGAGCCGTACTAATCACGGCCGTTCTTCTTCTCCTTTCCCTTCCGGTCTTAGCCGCTGGCATCACAATGCTACTAACAGACCGTAACCTAAACACAACTTTCTTTGACCCTGCCGGAGGGGGTGACCCCATCCTCTATCAGCACCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Limanda sakhalinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sakhalin sole

The Sakhalin sole, Limanda sakhalinensis, is a flatfish of the family Pleuronectidae. It is a demersal fish that lives on bottoms at depths of between 10 and 360 metres (33 and 1,180 ft), though it is most commonly found between around 50 and 100 metres (160 and 330 ft). Its native habitat is the polar waters of the northwestern Pacific, from the Sea of Okhotsk to the west and central Bering Sea, as far as the Pribilof Islands. It can reach up to 36 centimetres (14 in) in length, though the common length is around 21.5 centimetres (8.5 in). The maximum recorded weight is 500 grams (18 oz), and the maximum recorded lifespan is 8 years.[1][2]

Description

The Sakhalin sole is elongate to oval in shape, with a small mouth and a convex space between the eyes. It has a uniformly medium to dark brown upper side and a white underside. Its fins are brown, and its lateral line has a high to medium arch over the pectoral fin. It is similar in appearance to the yellowfin sole and the rock sole.[2]

Diet

The diet of the Sakhalin sole consists mainly of zoobenthos organisms, including polychaetes, amphipods, krill and other crustaceans.[1]

References

  1. ^ a b "Limanda sakhalinensis". Fishbase. 6 October 2010. http://www.fishbase.org/summary/Limanda-sakhalinensis.html. Retrieved 2011-08-04.
  2. ^ a b Kramer, Donald E.; Barss, William H.; Paust, Brian C.; Bracken, Barry E. (1995). "Sakhalin Sole". Guide to Northeast Pacific Flatfishes. Marine Advisory Bulletin no. 47. University of Alaska Fairbanks, Alaska Fisheries Development Foundation. pp. 80–81. http://nsgl.gso.uri.edu/aku/akuh95001.pdf. Retrieved 2011-08-04.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!