Overview

Comprehensive Description

Biology

Inhabits reef flats and seaward slopes to depths of more than 52 m where it is found in groups in caves and under ledges (Ref. 1602). Benthopelagic (Ref. 58302). Feeds mainly on polychaetes, also on crab megalops, hermit crab larvae, and larvae of alpheid shrimps (Ref. 12419). Forms large schools in oceanic locations (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean: Indonesia and the Philippines to Hawaii and Ducie Islands; north to Ryukyu Islands and Marcus Islands throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western and Central Pacific: Ryukyu Islands, Ogasawara Islands, Caroline Islands, Marshall Islands, Johnston Atoll, Hawaiian Islands, Society Islands, Tuamotu Archipelago, Pitcairn.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Analspines: 4; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 260 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

26.5 cm SL (male/unsexed; (Ref. 54980))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Fins are uniformly red and lack white leading edges or darker tips.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Myripristis amaena
Catalog Number: USNM 50632
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Myripristis amaena
Catalog Number: USNM 50631
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Myripristis amaena
Catalog Number: USNM 126539
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 25 - 52 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0.61 - 9.15
  Temperature range (°C): 24.610 - 29.336
  Nitrate (umol/L): 0.067 - 2.517
  Salinity (PPS): 34.113 - 36.148
  Oxygen (ml/l): 4.454 - 4.835
  Phosphate (umol/l): 0.092 - 0.495
  Silicate (umol/l): 1.097 - 1.952

Graphical representation

Depth range (m): 0.61 - 9.15

Temperature range (°C): 24.610 - 29.336

Nitrate (umol/L): 0.067 - 2.517

Salinity (PPS): 34.113 - 36.148

Oxygen (ml/l): 4.454 - 4.835

Phosphate (umol/l): 0.092 - 0.495

Silicate (umol/l): 1.097 - 1.952
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 25 - 52m.
From 25 to 52 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis amaena

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTCTAAGCCTTCTTATTCGAGCTGAGCTTAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTATAACGTAATCGTTACGGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGTTTCGGAAATTGACTTATTCCTCTAATGATCGGCGCCCCCGACATGGCATTCCCTCGAATAAACAATATAAGCTTCTGACTACTCCCTCCTTCTTTCCTGCTCCTCCTGGCCTCCTCAGGGGTAGAAGCCGGAGCTGGGACAGGATGAACTGTCTACCCACCCCTAGCAGGAAACTTAGCCCACGCAGGAGCTTCCGTTGATCTAACCATCTTCTCACTTCATCTAGCAGGAATCTCCTCAATTCTAGGGGCCATCAACTTCATCACAACAATTATTAACATGAAACCTCCAGCCATCTCTCAATACCAAACACCTCTGTTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTATCCCTTCCTGTCCTTGCTGCTGGCATCACCATGCTTCTAACTGACCGAAACCTAAACACCACCTTCTTTGACCCAGCTGGAGGTGGAGACCCAATTCTCTATC-ACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myripristis amaena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!