Myripristis amaena — Details

Squirrelfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits reef flats and seaward slopes to depths of more than 52 m where it is found in groups in caves and under ledges (Ref. 1602). Benthopelagic (Ref. 58302). Feeds mainly on polychaetes, also on crab megalops, hermit crab larvae, and larvae of alpheid shrimps (Ref. 12419). Forms large schools in oceanic locations (Ref. 48635).

Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419) http://www.fishbase.org/references/FBRefSummary.php?id=12419&speccode=12596

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Pacific Ocean: Indonesia and the Philippines to Hawaii and Ducie Islands; north to Ryukyu Islands and Marcus Islands throughout Micronesia.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Western and Central Pacific: Ryukyu Islands, Ogasawara Islands, Caroline Islands, Marshall Islands, Johnston Atoll, Hawaiian Islands, Society Islands, Tuamotu Archipelago, Pitcairn.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Analspines: 4; Analsoft rays: 12 - 13

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 260 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

26.5 cm SL (male/unsexed; (Ref. 54980))

Randall, J.E. 2005 Reef and shore fishes of the South Pacific. New Caledonia to Tahiti and the Pitcairn Islands. University of Hawaii Press, Honolulu, Hawaii. 720 p. (Ref. 54980) http://www.fishbase.org/references/FBRefSummary.php?id=54980&speccode=61658

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Fins are uniformly red and lack white leading edges or darker tips.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Type for Myripristis amaena
Catalog Number: USNM 50632
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific

Type:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Type for Myripristis amaena
Catalog Number: USNM 50631
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific

Type:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Cotype for Myripristis amaena
Catalog Number: USNM 126539
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific

Cotype:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; non-migratory; marine; depth range 25 - 52 m (Ref. 9710)

Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710) http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0.61 - 9.15
  Temperature range (°C): 24.610 - 29.336
  Nitrate (umol/L): 0.067 - 2.517
  Salinity (PPS): 34.113 - 36.148
  Oxygen (ml/l): 4.454 - 4.835
  Phosphate (umol/l): 0.092 - 0.495
  Silicate (umol/l): 1.097 - 1.952

Graphical representation

Depth range (m): 0.61 - 9.15

Temperature range (°C): 24.610 - 29.336

Nitrate (umol/L): 0.067 - 2.517

Salinity (PPS): 34.113 - 36.148

Oxygen (ml/l): 4.454 - 4.835

Phosphate (umol/l): 0.092 - 0.495

Silicate (umol/l): 1.097 - 1.952

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 25 - 52m.
From 25 to 52 meters.

Habitat: reef-associated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Inhabits coral reefs (Ref. 58534).

Hobson, E.S. 1974 Feeding relationships of teleostean fishes on coral reefs in Kona, Hawaii. Fish. Bull. 72(4):915-1031. (Ref. 13550) http://www.fishbase.org/references/FBRefSummary.php?id=13550&speccode=4734

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis amaena

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTCTAAGCCTTCTTATTCGAGCTGAGCTTAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTATAACGTAATCGTTACGGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGTTTCGGAAATTGACTTATTCCTCTAATGATCGGCGCCCCCGACATGGCATTCCCTCGAATAAACAATATAAGCTTCTGACTACTCCCTCCTTCTTTCCTGCTCCTCCTGGCCTCCTCAGGGGTAGAAGCCGGAGCTGGGACAGGATGAACTGTCTACCCACCCCTAGCAGGAAACTTAGCCCACGCAGGAGCTTCCGTTGATCTAACCATCTTCTCACTTCATCTAGCAGGAATCTCCTCAATTCTAGGGGCCATCAACTTCATCACAACAATTATTAACATGAAACCTCCAGCCATCTCTCAATACCAAACACCTCTGTTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTATCCCTTCCTGTCCTTGCTGCTGGCATCACCATGCTTCTAACTGACCGAAACCTAAACACCACCTTCTTTGACCCAGCTGGAGGTGGAGACCCAATTCTCTATC-ACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Myripristis amaena

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

aquarium: commercial

Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358) http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!