Overview

Comprehensive Description

Biology

More common in offshore areas, including floating seaweed and flotsam, and around islands. Juveniles are associated with floating seaweeds (Ref. 3790). Probably feeds on plants and small invertebrates (Ref. 3790). Generally considered as trash fish, rarely consumed (Ref. 3790).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Bermuda, North Carolina (USA), and northern Gulf of Mexico to southeastern Brazil (Ref. 57756). Indo-Pacific (Ref. 26165).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: from Bermuda, North Carolina (USA), and northern Gulf of Mexico to northern South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: North Carolina, Bermuda, and northern Gulf of Mexico to northern South America (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 27 - 29; Analspines: 0; Analsoft rays: 27 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

20.0 cm TL (male/unsexed; (Ref. 3790))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Profile from snout to origin of first dorsal spine nearly straight (Ref. 26938). No enlarged spines on caudal peduncle, but males with an elongate patch of bristle-like spinules (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 80 m (Ref. 5217)
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 0 - 40.2336
  Temperature range (°C): 23.731 - 27.724
  Nitrate (umol/L): 0.256 - 0.570
  Salinity (PPS): 35.209 - 36.210
  Oxygen (ml/l): 4.538 - 4.899
  Phosphate (umol/l): 0.088 - 0.165
  Silicate (umol/l): 0.921 - 2.444

Graphical representation

Depth range (m): 0 - 40.2336

Temperature range (°C): 23.731 - 27.724

Nitrate (umol/L): 0.256 - 0.570

Salinity (PPS): 35.209 - 36.210

Oxygen (ml/l): 4.538 - 4.899

Phosphate (umol/l): 0.088 - 0.165

Silicate (umol/l): 0.921 - 2.444
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Mainly offshore waters, including floating seaweed and flotsam, and around islands (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

More common in offshore areas, including floating seaweed and flotsam, and around islands. Juveniles are associated with floating seaweeds (Ref. 3790). Probably feeds on plants and small invertebrates (Ref. 3790).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Filefishes prefer sponges, sea whips, hydroids, and soft-bodied invertebrates (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stephanolepis setifer

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATATAATCTTTGGTGCCTGAGCAGGAATAGTGGGGACTGCTTTAAGCCTACTAATTCGGGCAGAGCTGAGCCAGCCCGGCGCCCTTCTTGGGGACGACCAAATGTACAATGTAGTCGTCACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATCATAATTGGAGGCTTTGGAAACTGACTTATTCCTCTTATGATCGGAGCTCCTGATATAGCATTCCCGCGTATGAATAACATGAGCTTTTGACTTCTGCCCCCTTCCTTCCTGCTTCTCCTTGCATCATCTGGGGTCGAGGCAGGAGCTGGTACCGGTTGGACTGTTTACCCCCCTCTTGCAGGCAACCTTGCCCACGCGGGAGCTTCTGTAGACTTAACTATCTTTTCTCTCCACCTGGCTGGTATCTCTTCAATTCTCGGAGCTATTAATTTTATCACTACAATTATAAATATAAAACCCCCTGCAATGACACAATATCAGATGCCCCTATTCGTATGAGCTGTTCTCGTTACTGCTGTCCTCCTACTTCTTTCATTACCTGTCCTGGCCGCAGGAATTACTATACTCTTAACAGATCGAAATTTAAACACTACCTTTTTTGACCCTGCAGGAGGTGGAGACCCTATCTTATACCAACACCTCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stephanolepis setifer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!