Overview

Comprehensive Description

Biology

Found usually in sandy or algal-rich areas near reefs or in seagrass beds. Feeds on amphipods, tanaids, pelecypods, brachyuran crabs, gastropods and polychaetes (Ref. 33411).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indian Ocean: northern Red Sea south to East London, South Africa and east to the northwest coast of Australia, extending to Shark Bay; including Green Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Coris caudimacula is found from the northern Red Sea and Gulf of Oman, south to East London in South Africa and east to the northwest coast of Australia, extending to Shark Bay; including Green Island. It is also found in east Sumatra and Bali.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aldabra, Comores, East Africa, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indian Ocean: East Africa, South Africa, Madagascar and Mascarenes east to western Indonesia and northwestern Australia, south to Shark Bay (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head with irregular bands; opercular flap with a black spot edged with yellow on posterior part; body with 4 pink salmon stripes, sometimes with broad dark bars on upper side; large diffuse blackish spot at base of caudal fin (Ref. 4392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 57 m (Ref. 33411), usually 3 - 25 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Coris caudimacula inhabits areas of sand and rubble near coral in lagoons, bays, and protected seaward reefs. It feeds on benthic organisms including small crustaceans and molluscs.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 2 - 52
  Temperature range (°C): 26.960 - 28.098
  Nitrate (umol/L): 0.052 - 1.522
  Salinity (PPS): 34.192 - 35.125
  Oxygen (ml/l): 4.406 - 4.700
  Phosphate (umol/l): 0.163 - 0.284
  Silicate (umol/l): 3.061 - 4.892

Graphical representation

Depth range (m): 2 - 52

Temperature range (°C): 26.960 - 28.098

Nitrate (umol/L): 0.052 - 1.522

Salinity (PPS): 34.192 - 35.125

Oxygen (ml/l): 4.406 - 4.700

Phosphate (umol/l): 0.163 - 0.284

Silicate (umol/l): 3.061 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 25m.
From 2 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Found usually in sandy or algal-rich areas near reefs or in seagrass beds. Feeds on amphipods, tanaids, pelecypods, brachyuran crabs, gastropods and polychaetes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coris caudimacula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACGGCTTTAAGCTTACTTATTCGAGCGGAACTGAGCCAGCCCGGCGCACTCCTTGGAGACGACCAGATTTACAACGTAATCGTTACGGCCCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGGTTTGGAAACTGGCTAATTCCTTTAATAATTGGGGCGCCTGACATGGCTTTCCCTCGTATAAATAATATAAGCTTTTGACTTCTGCCCCCCTCTTTCCTACTCCTTCTCGCATCTTCCGGCGTAGAAGCGGGTGCCGGAACTGGTTGAACAGTTTACCCCCCACTAGCAGGGAACCTTGCCCATGCCGGAGCATCTGTAGACCTTACTATTTTTTCCCTTCACTTAGCAGGCATCTCATCTATCCTGGGAGCAATTAACTTTATTACAACTATCATTAACATGAAGCCCCCTGCTATCTCGCAGTACCAAACACCCCTCTTTGTCTGAGCCGTTTTAATTACAGCAGTCCTACTTCTTCTATCCCTACCTGTCCTTGCTGCCGGTATTACAATGCTTCTTACAGACCGAAATCTAAACACCACTTTCTTTGACCCCGCAGGAGGAGGGGACCCAATTCTGTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coris caudimacula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Craig, M. & Sadovy, Y.J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Coris caudimacula has been assessed as Least Concern. This species has a broad geographic range and has been described as common throughout much of its range. It is not known to face any major threats at the present time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The species is considered to be common across much of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is not known to face any major threats, althoug it is likely to be undergoing localised declines in abundance in areas of coastal development and coastal pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures in place for this species, however its distribution coincides with a number of marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!