Overview

Comprehensive Description

Biology

Epipelagic to mesopelagic, at surface at night (Ref. 31442). Oviparous, with planktonic eggs and larvae (Ref. 31442).
  • Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Pacific: widely distributed in the area, from 30°N to 30°S. South China Sea (Ref.74511).
  • Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 14; Analspines: 0; Analsoft rays: 18 - 21; Vertebrae: 35 - 37
  • Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

6.0 cm TL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 8-9 (Ref. 31442).
  • Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 600 - 3132 m (Ref. 44036)
  • Chen, S. 2002 Fauna Sinica, Osteichthyes. Myctophiformes, Cetomimiformes, Osteoglossiformes. 349p. Fauna Sinica series. Beijing: Science Press. (Ref. 44036)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 100 - 1056
  Temperature range (°C): 4.020 - 12.863
  Nitrate (umol/L): 16.865 - 44.293
  Salinity (PPS): 34.031 - 34.662
  Oxygen (ml/l): 0.143 - 2.712
  Phosphate (umol/l): 1.698 - 3.391
  Silicate (umol/l): 18.478 - 120.634

Graphical representation

Depth range (m): 100 - 1056

Temperature range (°C): 4.020 - 12.863

Nitrate (umol/L): 16.865 - 44.293

Salinity (PPS): 34.031 - 34.662

Oxygen (ml/l): 0.143 - 2.712

Phosphate (umol/l): 1.698 - 3.391

Silicate (umol/l): 18.478 - 120.634
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 31442).
  • Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hygophum atratum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTGATCTTCGGTGCCTGAGCAGGCATAGTGGGCACTGCCCTAAGCCTTCTAATTCGCGCTGAACTAAGCCAACCCGGAGCCCTCCTGGGAGATGACCAAATCTACAATGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATGGTCATGCCAATTATAATTGGAGGCTTCGGAAACTGACTGATTCCCCTAATAATCGGCGCCCCTGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGGCTCCTGCCCCCCTCATTTCTCCTTCTCCTGGCCTCTTCTGGCGTAGAAGCTGGGGCCGGAACCGGTTGAACAGTCTACCCTCCTCTCGCAGGCAACCTCGCCCACGCCGGAGCCTCTGTTGACTTAACTATTTTCTCACTTCACCTGGCAGGTGTATCCTCCATCCTGGGTGCTATCAACTTTATTACAACTATTATCAATATAAAATCCCCAGCAATCTCCCAATACCAGACCCCCCTTTTCGTCTGAGCAGTCTTAATCACGGCCGTACTCCTCCTCCTCTCCCTCCCCGTACTAGCAGCTGGGATCACAATACTATTAACAGACCGAAATCTAAACACAACCTTCTTCGACCCTGCAGGCGGAGGAGACCCAATCCTTTACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hygophum atratum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!