Overview
Comprehensive Description
Biology
Epipelagic to mesopelagic, at surface at night (Ref. 31442). Oviparous, with planktonic eggs and larvae (Ref. 31442).
-
Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)
http://www.fishbase.org/references/FBRefSummary.php?id=9325&speccode=50707
Trusted
Distribution
Eastern Pacific: widely distributed in the area, from 30°N to 30°S. South China Sea (Ref.74511).
-
Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)
http://www.fishbase.org/references/FBRefSummary.php?id=9325&speccode=50707
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 14; Analspines: 0; Analsoft rays: 18 - 21; Vertebrae: 35 - 37
-
Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707
Trusted
Size
Diagnostic Description
Branchiostegal rays: 8-9 (Ref. 31442).
-
Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707
Trusted
Ecology
Habitat
Environment
bathypelagic; marine; depth range 600 - 3132 m (Ref. 44036)
-
Chen, S. 2002 Fauna Sinica, Osteichthyes. Myctophiformes, Cetomimiformes, Osteoglossiformes. 349p. Fauna Sinica series. Beijing: Science Press. (Ref. 44036)
http://www.fishbase.org/references/FBRefSummary.php?id=44036&speccode=7281
Trusted
Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.
Environmental ranges
Depth range (m): 100 - 1056
Temperature range (°C): 4.020 - 12.863
Nitrate (umol/L): 16.865 - 44.293
Salinity (PPS): 34.031 - 34.662
Oxygen (ml/l): 0.143 - 2.712
Phosphate (umol/l): 1.698 - 3.391
Silicate (umol/l): 18.478 - 120.634
Graphical representation
Depth range (m): 100 - 1056
Temperature range (°C): 4.020 - 12.863
Nitrate (umol/L): 16.865 - 44.293
Salinity (PPS): 34.031 - 34.662
Oxygen (ml/l): 0.143 - 2.712
Phosphate (umol/l): 1.698 - 3.391
Silicate (umol/l): 18.478 - 120.634
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 11 samples.
Environmental ranges
Depth range (m): 100 - 1056
Temperature range (°C): 4.020 - 12.863
Nitrate (umol/L): 16.865 - 44.293
Salinity (PPS): 34.031 - 34.662
Oxygen (ml/l): 0.143 - 2.712
Phosphate (umol/l): 1.698 - 3.391
Silicate (umol/l): 18.478 - 120.634
Graphical representation
Depth range (m): 100 - 1056
Temperature range (°C): 4.020 - 12.863
Nitrate (umol/L): 16.865 - 44.293
Salinity (PPS): 34.031 - 34.662
Oxygen (ml/l): 0.143 - 2.712
Phosphate (umol/l): 1.698 - 3.391
Silicate (umol/l): 18.478 - 120.634
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Life History and Behavior
Life Cycle
Oviparous (Ref. 31442).
-
Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442)
http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Hygophum atratum
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTCTACCTGATCTTCGGTGCCTGAGCAGGCATAGTGGGCACTGCCCTAAGCCTTCTAATTCGCGCTGAACTAAGCCAACCCGGAGCCCTCCTGGGAGATGACCAAATCTACAATGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATGGTCATGCCAATTATAATTGGAGGCTTCGGAAACTGACTGATTCCCCTAATAATCGGCGCCCCTGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGGCTCCTGCCCCCCTCATTTCTCCTTCTCCTGGCCTCTTCTGGCGTAGAAGCTGGGGCCGGAACCGGTTGAACAGTCTACCCTCCTCTCGCAGGCAACCTCGCCCACGCCGGAGCCTCTGTTGACTTAACTATTTTCTCACTTCACCTGGCAGGTGTATCCTCCATCCTGGGTGCTATCAACTTTATTACAACTATTATCAATATAAAATCCCCAGCAATCTCCCAATACCAGACCCCCCTTTTCGTCTGAGCAGTCTTAATCACGGCCGTACTCCTCCTCCTCTCCCTCCCCGTACTAGCAGCTGGGATCACAATACTATTAACAGACCGAAATCTAAACACAACCTTCTTCGACCCTGCAGGCGGAGGAGACCCAATCCTTTACCAGCACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Hygophum atratum
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


