Overview

Comprehensive Description

Biology

Epipelagic to mesopelagic, at surface at night (Ref. 31442). Oviparous, with planktonic eggs and larvae (Ref. 31442).
  • Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)   http://www.fishbase.org/references/FBRefSummary.php?id=9325&speccode=50707 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: widely distributed in the area, from 30°N to 30°S. South China Sea (Ref.74511).
  • Paxton, J.R., R.J. Lavenberg and C. Sommer 1995 Myctophidae. Linternillas. p. 1315-1321. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9325)   http://www.fishbase.org/references/FBRefSummary.php?id=9325&speccode=50707 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 14; Analspines: 0; Analsoft rays: 18 - 21; Vertebrae: 35 - 37
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

6.0 cm TL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 8-9 (Ref. 31442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 600 - 3132 m (Ref. 44036)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 100 - 1056
  Temperature range (°C): 4.020 - 12.863
  Nitrate (umol/L): 16.865 - 44.293
  Salinity (PPS): 34.031 - 34.662
  Oxygen (ml/l): 0.143 - 2.712
  Phosphate (umol/l): 1.698 - 3.391
  Silicate (umol/l): 18.478 - 120.634

Graphical representation

Depth range (m): 100 - 1056

Temperature range (°C): 4.020 - 12.863

Nitrate (umol/L): 16.865 - 44.293

Salinity (PPS): 34.031 - 34.662

Oxygen (ml/l): 0.143 - 2.712

Phosphate (umol/l): 1.698 - 3.391

Silicate (umol/l): 18.478 - 120.634
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 31442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hygophum atratum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTGATCTTCGGTGCCTGAGCAGGCATAGTGGGCACTGCCCTAAGCCTTCTAATTCGCGCTGAACTAAGCCAACCCGGAGCCCTCCTGGGAGATGACCAAATCTACAATGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATGGTCATGCCAATTATAATTGGAGGCTTCGGAAACTGACTGATTCCCCTAATAATCGGCGCCCCTGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGGCTCCTGCCCCCCTCATTTCTCCTTCTCCTGGCCTCTTCTGGCGTAGAAGCTGGGGCCGGAACCGGTTGAACAGTCTACCCTCCTCTCGCAGGCAACCTCGCCCACGCCGGAGCCTCTGTTGACTTAACTATTTTCTCACTTCACCTGGCAGGTGTATCCTCCATCCTGGGTGCTATCAACTTTATTACAACTATTATCAATATAAAATCCCCAGCAATCTCCCAATACCAGACCCCCCTTTTCGTCTGAGCAGTCTTAATCACGGCCGTACTCCTCCTCCTCTCCCTCCCCGTACTAGCAGCTGGGATCACAATACTATTAACAGACCGAAATCTAAACACAACCTTCTTCGACCCTGCAGGCGGAGGAGACCCAATCCTTTACCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hygophum atratum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!