Overview

Comprehensive Description

Biology

Prefers lower and middle sections of rivers in slow moving waters (Ref. 7335). Lives in mud-bottomed and sand-bottomed canals and rocky ponds (Ref. 5723). Stays close to the shoreline vegetation for protection (Ref. 44091). Omnivorous, but feeds mainly on algae (Ref. 6466). Used in behavioral studies (Ref. 4537). Aquarium keeping: minimum aquarium size 100 cm (Ref. 51539).
  • Conkel, D. 1993 Cichlids of North and Central America. T.F.H. Publications, Inc., USA. (Ref. 7335)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Atlantic Slope from Rio Tonala, Veracruz, Mexico, to southern Belize. Introduced and established in Dade County, Florida, and in Hawaii; also introduced in Arizona (Page and Burr 1991, Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central America: Atlantic slope, in the Usumacinta River drainage, the Belize River drainage, and near Progreso, in Mexico, Guatemala and Belize.
  • Kullander, S.O. 2003 Cichlidae (Cichlids). p. 605-654. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic Slope: Belize, Colombia (introduced), Guatemala and Mexico; introduced in Hawaiian Islands and Florida, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 17 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 5723))
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Thorichthys helleri meeki
Catalog Number: USNM 79243
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Yucatan, Mexico, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Mud- and sand-bottomed canals and rocky ponds (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; pH range: 6.5 - 7.5; dH range: 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Prefers lower and middle sections of rivers in slow moving waters (Ref. 7335). Lives in mud- and sand-bottomed canals and rocky ponds (Ref. 5723). Omnivorous, but feeds mainly on algae. Showed quantitative diel, ontogenetic and seasonal diet changes (Ref. 78170).
  • Conkel, D. 1993 Cichlids of North and Central America. T.F.H. Publications, Inc., USA. (Ref. 7335)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Yellow Grub. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Valipora Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uvulifer Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stunkardiella Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spiroxys Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Serpinema Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sciadicleithrum Infection 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pseudoterranova Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Infection 13. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Posthodiplostomum Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perezitrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pelaezia Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oligogonotylus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neoechinorhynchus Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genarchella Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

False Fungal Infection (Epistylis sp.). Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

False Fungal Infection (Apiosoma sp.). Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 1997 Color guide of tropical fish diseases: on freshwater fish. Bassleer Biofish, Westmeerbeek, Belgium. 272 p. (Ref. 41805)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Falcaustra Infection (Falcaustra sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diplostomum Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Crassicutis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotylurus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Contracaecum Disease (larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cladocystis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bothriocephalus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ascocotyle Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ascocotyle Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Apharyngostrigea Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Deposits eggs on open substrate such as stones (Ref. 6466), a piece of submerged wood, or a shallow depression excavated in the substrate; from 100 to 500 eggs are deposited and guarded by both parents; newly hatched young are transferred to shallow pits and the parents continue guarding them (Ref. 44091).
  • Lee, D.S., C.R. Gilbert, C.H. Hocutt, R.E. Jenkins, D.E. McAllister and J.R. Stauffer 1980 Atlas of North American freshwater fishes. North Carolina State Museum of Natural History. 867 p. (Ref. 6466)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thorichthys meeki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTACCTAGTTTTTGGTGCCTGGGCCGGAATAGTAGGAACCGCCTTAAGCCTGCTGATCCGAGCAGAACTCAGCCAACCGGGCTCTCTCCTTGGAGATGACCAAATTTATAACGTAATCGTAACTGCACACGCCTTTGTAATAATTTTCTTTATAGTCATACCTATCATAATTGGAGGCTTCGGAAACTGACTAGTCCCACTCATGATTGGCGCCCCAGACATGGCCTTCCCACGGATGAATAACATGAGTTTTTGACTTCTCCCCCCTTCATTTCTCCTTCTCCTCGCTTCATCGGGAGTCGAAGCTGGCGCTGGGACAGGATGAACCGTCTACCCCCCACTAGCAGGCAATCTGGCACACGCTGGCCCCTCAGTCGACCTGACCATCTTCTCCCTTCATTTGGCGGGGGTCTCATCTATTCTTGGAGCAATCAACTTTATTACCACAATTATTAACATAAAACCTCCAGCAATTTCCCAATATCAAACCCCCCTATTTGTCTGGGCAGTTTTAATTACCGCCGTCCTACTCCTGCTATCCCTACCAGTCCTTGCTGCAGGCATCACAATACTTCTAACAGATCGAAACCTAAACACAACCTTCTTTGACCCGGCCGGAGGAGGAGACCCCATTCTTTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thorichthys meeki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 85
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Popular aquarium fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: of no interest; aquarium: highly commercial
  • Mills, D. and G. Vevers 1989 The Tetra encyclopedia of freshwater tropical aquarium fishes. Tetra Press, New Jersey. 208 p. (Ref. 7020)
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Firemouth cichlid

The firemouth cichlid (Thorichthys meeki) is a species of cichlid fish native to Central America. They occur in rivers of the Yucatán Peninsula, Mexico, south through Belize and into northern Guatemala. Their natural habitat is typically shallow, slow-moving, often turbid, water with a pH of 6.5 - 8.0. It has also been reported to live in underground cave systems. As fish with a tropical distribution, firemouth cichlids live in warm water with a temperature range of 23–30 °C (75–86 °F). The common name, firemouth, is derived from the bright orange-red colouration on the underside of the jaw. Males in particular flare out their gills, exposing their red throats, in a threat display designed to ward off male rivals from their territory. Like most cichlids, brood care is highly developed; this species is an egg-layer. Firemouth cichlids form monogamous pairs and spawn on flattened surfaces of rocks, leaves or submerged wood. Breeding males are primarily responsible for territorial defense, while females are more intensively involved in raising the fry, though both parents lead the fry in search of food. Firemouth cichlids are omnivorous and opportunistic in their feeding strategies. Their ability to protrude their jaw 6% standard length limits their diet to about 6% evasive prey. [1] Sexual dimorphism is present, though limited in this species. Males are generally larger, (up to 15 cm), than females with brighter and more red colouration around the throat, they also have more pointed dorsal and anal fins. Firemouths are suitable for community aquaria, though they may become aggressive to other members of its species during spawning.

See also[edit]

References[edit]

  1. ^ Hulsey, C. D.; Garcia De Leon, F. J. (2005). "Cichlid jaw mechanics: Linking morphology to feeding specialization". Functional Ecology 19 (3): 487. doi:10.1111/j.1365-2435.2005.00987.x.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!