Overview

Brief Summary

Anabas testudineus is a small fish from Indian waters commonly called as climbing perch.  Testudineus means “turtle like" (1) .  Its common name in Bengali is Koi and in Telugu it is called as “Gorkalu”.

This is a fish widely distributed throughout south and southeast Asia. It is a very common fish found in the river and pond waters of Machilipatnam and Eluru of Andhra Pradesh. It is a Bengali delicacy and is frequently exported to West Bengal from Eluru. This fish is a column feeder and a larvicidal fish (feeds upon mosquito larvae (2) ) and hence used to control mosquito larvae. Anabas is grayish green in color and has brown fins. It grows up to 9 inches and is a very hardy fish, due to the presence of accessory respiratory organ. (Rosette like structures found very close to the pectoral fin) and is known to survive for 8 years in captivity (3).  Basically a carnivorous fish, is also known to eat rice (4).  

Body is covered by cycloid scales. Lateral line sense organ is identified by the black spots as conspicuous one at the base of the caudal fin (5).  

Male and female fishes are identified only during the breeding season, by the difference in their color. During the breeding season, the females show a brilliant orange color with shades of yellow on the ventral side of the abdomen and also on the pelvic fin. During spawning season the abdomen of the female is slightly bulged out (6).  

Climbing perch can live in water low in oxygen, polluted water, and also water with rotting vegetation. In such waters, the fish rises to surface and gulps air.  Anabas can survive out of water for about 6-10 hours (7).  

During dry seasons, the fish burrows in the mud and is in resting phase. It is interesting to see the fish travelling in troops on the ground, during early morning and at times of rain storm. This is a migratory fish, migrating from one pond to another during rainy season for spawning (8).

Legend about the Climbing Perch: As this fish is frequently found on tree tops and also found hanging from trees or living in water filled slits of a palm tree. (9)  It was believed that the fish would travel and climbing the trees. This was observed and confirmed by Lieutenant Daldrof of the Danish East India Company in the year 1797, so people believed it to be truly climbing perch for nearly 250 years. It was in the year 1927, that this myth about this fish as climbing perch was clarified by the study of B.K Das (10) an Indian expert on fishes.

This fish, when travelling as troops are often caught by birds such as pond crows and kites catch and carry them off and park them on tree tops, and slits of trees. Perch can live without water for days and so were found alive on most of tree tops and hence the name as climbing perch. As the myth has been cleared, it is more appropriately now called as “Walking Perch” rather than as climbing perch (11).

  • Das,B.K (1927) “ The Bionics of certain air breathing fishes of Indian, together with an account of the development of their air breathing organs” Phil. Trans .Ser.B 216: 433; 183-219
  • Flower, (1925) “ Contributions to our knowledge of the duration of life in vertebrate animals I. Fishes; Journal; Proc Zool Society, London 1; 247-267
  • G.Chandra, I.Bhattacharjee, S.N Chatterjee and A.Ghosh(2008); “Mosquito Control by larvivorous fish”; Indian Journal of Medical Research 127; pp-13-27
  • Hughes ,G.M and Singh , B.N (1970) “ Respiration in an air breathing fish, the climbing perch, Anabas testudineus (Bloch) I .Oxygen uptake and carbon dioxide release in to air and water” J Expt Biology 53;265-280
  • Jeffery B.Graham (1997); in the book titled “Air breathing Fishes, Evolution, diversity and adaptation” Academic Press
  • Jesse Mitchell (1864), “On the Climbing habits of Anabas Scandens”, Annals and Magazine of Natural History 13; 117-119
  • Maurice Burton,(1984) ; Encyclopedia of reptiles, amphibians and other cold blooded animals; BPC Publishers
  • Natarajan, G.M (1972); “ Studies on the respiration of Anabas scandens (Cuvier)”, M.Sc thesis submitted to ICAR, New Delhi, INDIA
  • R.Premakumari (1988); PhD thesis titled “ Some aspects of physiology of fish under nutritional stress” submitted to Osmania University, Hyderabad, INDIA
  • Shantha Vijaya raghavan, (1981); “ Some aspects of Physiology of digestion on fish. PhD thesis ; Osmania University, Hyderabad, INDIA
  • http://www.aquarium-glaser.de/en/anabas-cf-macrocephalus_en_1177.html
Creative Commons Attribution 3.0 (CC BY 3.0)

© Padmavathi Godavarthy

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found mostly in canals, lakes, ponds, swamps and estuaries (Ref. 41236, 57235). Adults occur in medium to large rivers, brooks, flooded fields and stagnant water bodies including sluggish flowing canals (Ref. 12975). Often found in areas with dense vegetation (Ref. 12693). Can tolerate extremely unfavorable water conditions and is associated mainly with turbid, stagnant waters (Ref. 6028). They remain buried under the mud during dry season (Ref. 1479). Feed on macrophytic vegetation, shrimps and fish fry (Ref. 6028). Reported to undertake lateral migration from the Mekong mainstream, or other permanent water bodies, to flooded areas during the flood season and return to the permanent water bodies at the onset of the dry season (Ref. 37770). During the dry season, they stay in pools associated with submerged woods and shrubs (Ref. 37770). Posses an accessory air-breathing organ (Ref. 2847). Able to survive for several days or weeks out of water if the air breathing organs can be kept moist (Ref. 1479). Quite famous for its ability to walk; important food fish in SE Asia, considered as a tasty food fish (Ref. 6565) but not of the finest quality since it is bony (Ref. 2686). Usually sold live in markets where it is kept alive for several days by keeping it moist (Ref. 12693). Economic foodfish in the Southeast Asia (Ref. 57235).
  • Talwar, P.K. and A.G. Jhingran 1991 Inland fishes of India and adjacent countries. Volume 2. A.A. Balkema, Rotterdam. (Ref. 4833)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The species complex is widely distributed in Pakistan, India, Bangladesh, Nepal, Bhutan (most likely), Sri Lanka, Myanmar, Thailand, Cambodia, Laos, Vietnam, southern China, Malaysia, Indonesia, Brunei, Singapore and introduced to the Philippines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific [native to southeastern Asia from India to Sri Lanka to Indonesia, Philippines and China]; introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: India to Wallace line including China. May have been distributed in more areas than were commonly reported.
  • Talwar, P.K. and A.G. Jhingran 1991 Inland fishes of India and adjacent countries. Volume 2. A.A. Balkema, Rotterdam. (Ref. 4833)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 16 - 20; Dorsal soft rays (total): 7 - 10; Anal spines: 9 - 11; Analsoft rays: 8 - 11
  • Herre, A.W.C.T. 1924 Distribution of the true freshwater fishes in the Philippines. II. Philippine Labyrinthici, Clariidae, and Siluridae. Philipp. J. Sci. 24(6):683-709. (Ref. 2854)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 4833))
  • Talwar, P.K. and A.G. Jhingran 1991 Inland fishes of India and adjacent countries. Volume 2. A.A. Balkema, Rotterdam. (Ref. 4833)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Color in life dark to pale greenish, very pale below, back dusky to olive; head with longitudinal stripes ventrally; posterior margin of opercle with a dark spot; iris golden reddish. Body form variable, affected by age and amount of food consumed. Scaled head with 4-5 rows between eye and rear margin of preoperculum. Scales large and regularly arranged, ciliate.
  • Herre, A.W.C.T. 1924 Distribution of the true freshwater fishes in the Philippines. II. Philippine Labyrinthici, Clariidae, and Siluridae. Philipp. J. Sci. 24(6):683-709. (Ref. 2854)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits fresh waters; mostly in rivers, canals, lakes, ponds, swamps and paddy fields.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish; depth range 0 - ? m (Ref. 4833)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Talwar, P.K. and A.G. Jhingran 1991 Inland fishes of India and adjacent countries. Volume 2. A.A. Balkema, Rotterdam. (Ref. 4833)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.75 - 2

Graphical representation

Depth range (m): 0.75 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found mostly in canals, lakes, ponds, swamps and estuaries (Ref. 41236). Occurs in medium to large rivers, brooks, flooded fields and stagnant water bodies including sluggish flowing canals (Ref. 12975). Often found in areas with dense vegetation (Ref. 12693). Can tolerate extremely unfavorable water conditions and is associated mainly with turbid, stagnant waters (Ref. 6028). Remains buried under the mud during dry season (Ref. 1479). Feeds on macrophytic vegetation, shrimps and fish fry (Ref. 6028). Reported to undertake lateral migration from the Mekong mainstream, or other permanent water bodies, to flooded areas during the flood season and return to the permanent water bodies at the onset of the dry season (Ref. 37770). During the dry season, it stays in pools associated with submerged woods and shrubs (Ref. 37770). Possesses an accessory air-breathing organ (Ref. 2847). Able to survive for several days or weeks out of water if the air breathing organs can be kept moist (Ref. 1479); uses its highly mobile suboperculum and strong fins spines to pull itself over land to move between bodies of water (Ref. 76895).
  • Rainboth, W.J. 1996 Fishes of the Cambodian Mekong. FAO Species Identification Field Guide for Fishery Purposes. FAO, Rome, 265 p. (Ref. 12693)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Tripartiella Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellantchasmus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procerovum Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procerovum Infestation 1. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paragendria Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neopecoelina Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lernaea Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gnathostoma Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Centrocestus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Camallanus Infection 8. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Camallanus Infection 1. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchor worm Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Allocreadium Infestation 6. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Guards eggs at the surface of hypoxic waters (Ref. 7471).
  • Balon, E.K. 1990 Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev. 1:1-48. (Ref. 7471)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anabas testudineus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCATTTGTCTTCGGTGCTTGAGCTGGAATAGTGGGCACCGCTCTAAGCCTTCTAATTCGTGCTGAATTAAGCCAGCCAGGCTCCCTTTTAGGTGACGACCAGATTTTTAATGTAATCGTCACAGCACACGCTTTCGTAATGATTTTCTTTATAGTAATGCCAATGATAATCGGGGGCTTCGGAAACTGACTAGTTCCCCTAATGATCGGCGCACCAGATATGGCTTTCCCTCGAATAAACAACATAAGCTTCTGACTCCTTCCACCCTCTTTCCTCCTTCTCCTTGCCTCTGCTGCAGTAGAAGCCGGAGCAGGAACGGGTTGAACCGTTTATCCCCCCTTAGCCAGCAACCTAGCCCACGCAGGAGCATCCGTAGATTTAACCATCTTTTCCCTACACTTGGCCGGAGTTTCTTCTATCTTAGGTGCAATTAACTTCATTACAACAATTATTAACATAAAACCTCCTGCCGCCTCTCAATATCAAACACCCCTGTTTGTCTGATCTGTTCTTATTACCGCTGTTCTTCTTCTCCTCTCCCTTCCCGTCCTTGCTGCTGGAATTACTATGCTTCTTACAGATCGGAACCTGAACACCTCCTTCTTTGACCCAGCAGGCGGAGGAGATCCAATTCTTTACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anabas testudineus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pal, M. & Chaudhry, S.

Reviewer/s
Britz, R., Ng, H.H. & Molur, S.

Contributor/s
Molur, S.

Justification
The taxonomic problems associated with this species make it difficult to accurately assess this species, as what is now identified as A. testudineus is part of a species complex and almost certainly consists of more than one species. Until the taxonomic confusion is resolved, A. testudineus is categorized as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Although this is considered to be a widespread and abundant species, it almost certainly consists of more than one species that would be more geographically circumscribed. Therefore, information on the population status should be considered to be poorly known (H.H. Ng and R. Britz pers. comm. 2010).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There is no information available about the threats to this species. This is compounded by the taxonomic problems associated with this species (H.H. Ng and R. Britz pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The taxonomic problems surrounding the identity of this species need to be resolved. More information about the population size and trends, as well as harvest levels and threats are also needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; aquarium: commercial
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • Mills, D. and G. Vevers 1989 The Tetra encyclopedia of freshwater tropical aquarium fishes. Tetra Press, New Jersey. 208 p. (Ref. 7020)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Anabas testudineus

Anabas testudineus, the climbing perch, is a species of fish in the family Anabantidae, the climbing gourami. It is native to Asia, where it occurs from India east to China and to the Wallace Line. It has also been established in some countries outside of its native range.

This species grows to 25 cm (9.8 in) in total length.

It is likely that this is a species complex, with the name Anabas testudineus applied to what are actually several different species. With further study, populations of this fish may be divided up into separate species and given new names.[1]

As food[edit]

This species is important as a food fish in certain areas of India and in Southeast Asia, where its ability to survive out of the water for extended periods of time, provided it is kept moist, improves its marketability.[2]

Pla mo at a riverside market in Ratchaburi Province, Thailand
Anabas testudineus curry preparation

See also[edit]

References[edit]

  1. ^ Pal, M. & Chaudhry, S. 2010. Anabas testudineus. The IUCN Red List of Threatened Species. Version 2014.2. Downloaded on 22 September 2014.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2012). "Anabas testudineus" in FishBase. December 2012 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!