Articles on this page are available in 1 other language: Arabic (17) (learn more)

Overview

Comprehensive Description

Biology

Found near or on bottoms (Ref. 2850). Feed on small crustaceans. Regarded as inferior food because of its soft, fleshy texture (Ref. 4525). Oviparous, with mesopelagic and bathypelagic larvae (Ref. 35724).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Bering Sea to at least California, USA. Southeast Pacific: Chile (Ref. 35724).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 15 - 18; Analspines: 0; Analsoft rays: 15 - 18; Vertebrae: 51 - 55
  • Ambrose, D.A. 1996 Alepocephalidae: slickheads. p. 224-233. In H.G. Moser (ed.) The early stages of fishes in the California Current region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505p. (Ref. 35724)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 610 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

61.0 cm TL (male/unsexed; (Ref. 2850))
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 6-7.
  • Ambrose, D.A. 1996 Alepocephalidae: slickheads. p. 224-233. In H.G. Moser (ed.) The early stages of fishes in the California Current region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505p. (Ref. 35724)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 46 - 1524m.
From 46 to 1524 meters.

Habitat: bathydemersal. Lives near and on bottom.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 46 - 5500 m (Ref. 4525)
  • Fitch, J.E. and R.J. Lavenberg 1968 Deep-water teleostean fishes of California. California Natural History Guides:25. University of California Press, Berkeley and Los Angeles, California. 115 p. (Ref. 4525)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 512.4 - 1267.5
  Temperature range (°C): 3.575 - 5.715
  Nitrate (umol/L): 39.609 - 44.379
  Salinity (PPS): 34.201 - 34.516
  Oxygen (ml/l): 0.303 - 0.731
  Phosphate (umol/l): 3.067 - 3.485
  Silicate (umol/l): 79.122 - 134.948

Graphical representation

Depth range (m): 512.4 - 1267.5

Temperature range (°C): 3.575 - 5.715

Nitrate (umol/L): 39.609 - 44.379

Salinity (PPS): 34.201 - 34.516

Oxygen (ml/l): 0.303 - 0.731

Phosphate (umol/l): 3.067 - 3.485

Silicate (umol/l): 79.122 - 134.948
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 35724).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alepocephalus tenebrosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTCTTCTCCACCAACCACAAAGACATTGGCACCCTTTATTTAGTATTCGGTGCCTGAGCCGGAATAGTTGGCACGGCTCTCAGCCTCTTAATTCGAGCCGAGCTAAGCCAGCCCGGCGCCCTCCTAGGCGAT---GACCAAATTTATAATGTCATCGTCACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATCATGATCGGAGGCTTTGGAAACTGGCTACTCCCCCTAATACTGGGAGCCCCTGACATAGCATTCCCTCGAATGAACAACATGAGTTTCTGACTTCTACCCCCTTCGCTCCTCCTCCTCCTTTCATCCTCAGGGGTTGAAGCCGGAGTAGGGACAGGATGAACCGTCTATCCCCCCTTAGCCGGCAACTTAGCCCACGCCGGTGCCTCTGTAGACCTCGCCATCTTCTCTTTACACCTAGCGGGCGTCTCCTCAATTCTGGGGTCAATTAATTTTATTACCACAATTACCAACATGAAACCCCCAGCCATCTCCCAATATCAGACACCCCTGTTCGTGTGGGCCGTTCTCATCACTGCTGTCCTACTTCTTCTGTCTCTTCCAGTTCTAGCTGCCGGTATTACCATGCTTCTTACAGACCGAAATCTAAACACAACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTATACCAACACCTATTCTGGTTCTTTGGCCACCCTGAGGTATACATTCTAATCCTGCCTGGATTTGGCATCATCTCACACATTGTCGCGTACTACTCCGGTAAAAAAGAACCATTCGGCTATATAGGCATGGTTTGAGCTATAATAGCCATCGGACTCCTAGGGTTTATTGTTTGAGCCCACCACATGTTTACGGTGGGAATGGACGTAGACACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alepocephalus tenebrosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!