Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occur in clear, current-swept terraces of seaward reefs. Observed in loose aggregations 1 or 2 meters above the bottom; juveniles and subadults typical in groups near isolated Pocillopora eydouxi coral heads and when alarmed hide themselves tightly among the branches (Ref. 9710). Benthopelagic (Ref. 58302). Feed on zooplankton and occasionally on algae (Ref. 9710, 48637, 27115, 83665). Relatively uncommon and highly localized (Ref. 1602, 9710). Very popular and hardy aquarium fish. Anterolateral glandular groove with venom gland (Ref. 57406).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Paracanthurus hepatus is found from East Africa to Micronesia, Line Islands and Samoa Islands, northwards to Kochi Prefecture, southwards to New South Wales, Australia. Two instances of vagrants found in Hawaii are probably aquarium releases.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to Kiribati, north to southern Japan, south to the southern Great Barrier Reef, New Caledonia, and Samoa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Common surgeon, Paracanthurus hepatus, are strictly marine fish that typically inhabit tropical coral reefs in waters with a strong current. They may move seasonally, occurring at higher latitudes when water temperatures allow. Generally, common surgeon range between 30° north and south latitude and 32° east to 170° west longitude in the Indian and Pacific Oceans. Individuals found in other areas are presumed to have been released from aquaria.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Marshall Islands and Line Islands, north to southern Japan and Ogasawara Islands, south to southern Great Barrier Reef (Australia), New Caledonia and Samoa
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 19 - 20; Analspines: 3; Analsoft rays: 18 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Common surgeon are characterized by the vibrant sky blue coloration of their oval-shaped bodies. Structures called iridophores on the exterior of the fish contribute to this coloration. Adults have dark narrow lines of dark blue on the dorsal half of their body. This color extends from the eye on the anterior end and continues to the posterior end. This coloration is darker near the posterior end and is black near the tail. A circular patch of sky blue coloration is located directly behind the pectoral fin. The pectoral and caudal fins are are bright yellow. The yellow extends in a "V" shape from the caudal fin to a point just beyond the caudal spine.

Coloration of common surgeon changes as they mature; juveniles are bright yellow with blue spots near their eyes, and their dorsal and anal fins are tipped in light blue. Their body becomes blue as they mature.

Adults range from 12 to 38 cm in length, averaging 25 to 31 cm. Common surgeon weigh on average 600 g. Males are typically larger than females.

Because many surgeonfish are similiar in size and color, species of surgeonfish are distinguished by the number of spines they possess. Common surgeon have 9 hard, sharp spines in their dorsal fin followed by 19 to 20 soft rays. Their anal fins have 3 spines and 18 to 19 rays. Their pectoral fins consist of 16 rays, and their pelvic fins have 1 spine and 3 rays.

Common surgeon have a razor-sharp caudal spine located at the base of their caudal fin. This spine contains toxins that can cause a debilitating pain to small predators and uncomfortable irritation and pain in humans. The caudal spine rests in a groove below the surface of the skin and can be extended from the body. Its base is attached to the vertebrae of the fish by a ligament directly connecting the two. The outer point of the spine is free to move with contraction of specific muscles. When threatened, a common surgeon extends its caudal spine and attempts to puncture the exterior of a predator.

Average mass: 600 g.

Range length: 12 to 38 cm.

Average length: 25 to 31 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; poisonous ; venomous

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 310 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

31.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in clear, current-swept terraces of seaward reefs. Observed in loose aggregations 1 or 2 meters above the bottom; juveniles and subadults typical in groups near isolated @Pocillopora eydouxi@ coral heads and when alarmed hide themselves tightly among the branches. Relatively uncommon and highly localized in occurrence throughout most of Micronesia. A very popular and hardy aquarium fish.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bright blue, yellow and black in color (Ref. 3145).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Paracanthurus hepatus is typically found in clear water on exposed outer reef areas or in channels where there is consistent moderate to strong current.

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). It forms spawning aggregations around outer reef slopes and is believed to spawn all year during the new/full moon (Johannes 1981). It was observed to form spawning aggregations in January, February and March at Escape Reef, northern Great Barrier Reef spawning in the late afternoons (Robertson 1983, Squire and Samoilys unpub.).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 40 m (Ref. 1602), usually 10 - 40 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common surgeon are strictly marine and can be found in tropical and sub-tropical coastal regions where temperatures are between 24 and 26 °C. They congregate near Pocillopora eydouxi, a type of coral with branching extensions, which serve as a protective hiding place when threatened. Reefs provide plant material, such as algae, necessary as food for common surgeon. Common surgeon remain at epipelagic depths between 2 and 40 m.

Range depth: 2 to 40 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 20
  Temperature range (°C): 27.134 - 28.764
  Nitrate (umol/L): 0.146 - 0.622
  Salinity (PPS): 33.950 - 35.125
  Oxygen (ml/l): 4.522 - 4.700
  Phosphate (umol/l): 0.055 - 0.207
  Silicate (umol/l): 2.169 - 4.102

Graphical representation

Depth range (m): 0 - 20

Temperature range (°C): 27.134 - 28.764

Nitrate (umol/L): 0.146 - 0.622

Salinity (PPS): 33.950 - 35.125

Oxygen (ml/l): 4.522 - 4.700

Phosphate (umol/l): 0.055 - 0.207

Silicate (umol/l): 2.169 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 40m.
From 2 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

It is generally found in clear water of outer reefs or channels where there are strong currents. Juveniles tend to hide among the branches of live coral (Ref. 54301). Occurs in clear, current-swept terraces of seaward reefs. Observed in loose aggregations 1 or 2 meters above the bottom; juveniles and subadults typical in groups near isolated Pocillopora eydouxi coral heads and when alarmed hide themselves tightly among the branches. Feeds on zooplankton (Ref. 9710, 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Common surgeon are herbivorous. Unlike many marine fish, common surgeon rely only slightly on plankton. Instead, they graze on algae, using their small teeth to pull algae from rocks and coral. Fish of this species also feed on microalgae, other marine plants, and zooplankton.

Animal Foods: zooplankton

Plant Foods: algae; phytoplankton

Other Foods: detritus

Primary Diet: herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Common surgeon feed largely on algae. Due to the small shape of their mouth, surgeonfish can easily pick and remove algae from uneven surfaces. Aggregations of common surgeon eat the fast growing algae from sponges in their habitat. This benefits the sponges and indirectly preserves habitat for species dependent on the steady growth of sponges. Midnight parrotfish mimic the coloration of common surgeon and often join their groups for protection.

If kept in an aquarium, common surgeon are vulnerable to many potentially lethal parasites. The most common of these is known as ich, paravortex, or marine spot disease, and is caused by the parasite, Cryptocaryon irritans. Ich causes dark spots along the sides of the fish, which may be difficult to detect against the dark blue coloration of this species. Common surgeon may be more prone to catching these types of diseases than other aquarium fish because they do not produce as much of the protective coating of slime as other species.

Ecosystem Impact: creates habitat

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Common predators of common surgeon include tuna, bar jacks, and tiger groupers.

Common surgeon possess multiple anti-predator adaptations. Their razor-sharp caudal spine is venomous and can cause debilitating pain to small predators. The effectiveness of this defense mechanism is enhanced by the tendency of this species to congregate. If a predator were to attack a group of common surgeon, it would become surrounded by surgeonfish that were thrashing their tails and slashing with their protrusible caudal spines. Common surgeon also display bright aposematic coloration, warning predators of their poisonous skin and venomous spine.

Other species take advantage of these defense mechanisms. Midnight parrotfish, for example, display a similar blue coloration and join groups of common surgeon for protection.

Known Predators:

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Hole-in-the-Head Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common surgeon can communicate by changing their coloration. This color change depends on the conditions and how they perceive their environment. Under stress, for example, their blue coloration deepens. The black marks along the body may become bleached slightly and the markings less visible. The iridiphores causing the bright blue coloration appear smaller and less iridescent, hence the darker shade of blue. Other fish in the community can detect this color change and infer potential problems. Color change also occurs during stimulation such as male dominance interactions or breeding.

The coloration around the caudal spine serves as a warning to other species. In common surgeon, the yellow triangular coloration extends just beyond the caudal spine. In other species of surgeonfish, the location of the caudal spine may even be emphasized by a color that is not otherwise present on the body of the fish.

Communication Channels: visual

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Larvae of common surgeon hatch about 26 hours after the small eggs are laid. Larvae are severely underdeveloped and lack a heart beat at hatching. Larvae are nourished by yolk from the egg. Newly hatched larvae are buoyant but remain in a resting state until the heart begins to beat, up to 5 hours after hatching.

Two days after hatching, fins and pigment in the eyes begin to develop, and larvae begin to make short swimming movements. Development continues with jaws and the gut, and by the seventh day scales and intestines begin to form. Speed of development is related to light intensity. Larvae mature after about 37 days.

Juvenile common surgeon resemble adults, however, they differ in coloration. Juveniles also have a more rounded caudal fin than adults. Additionally, the ventral and poster tips the caudal fin in adults extend beyond the middle section of the fin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Common surgeon can live more than 30 years in the wild. In aquariums, where they more readily acquire diseases, common surgeon generally do not live more than 20 years and more commonly survive only 8 to 12 years.

Range lifespan

Status: wild:
30+ (high) years.

Range lifespan

Status: captivity:
20 (high) years.

Typical lifespan

Status: captivity:
8 to 20 years.

Average lifespan

Status: captivity:
12 to 14 years.

  • Dunder, J. 2003. "Paracanthurus hepatus-Blue Hippo Tang or Regal Tang" (On-line). Accessed April 10, 2010 at http://www.freeinfosociety.com/site.php?postnum=823.
  • Finacom, A., S. Linder, P. Schmidt. 2008. A View of the Philippine Coral Reef. San Francisco: California Academy of Sciences.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Common surgeon congregate in breeding groups, composed of both males and females. These groups spontaneously form. Groups dissolve and reform several times prior to spawning. A group begins to swim upward and, at the crest of this upward movement, they release their gametes. Common surgeon are broadcast spawners; eggs and sperm are released directly into the water, and fertilization takes place externally. The quickened pace of their swimming during breeding is believed to allow for dispersal and mixing of the sperm and eggs. Eggs are then carried away by currents.

On occasion, common surgeon have been observed breeding with individual mates rather than in groups. In this case, a male's coloration may change. The male and female then circle around one another, showing off their coloration before breeding.

Mating System: monogamous ; polygynandrous (promiscuous)

Common surgeon breed during cooler months, though time of year varies with location and water temperature. In the Pacific, breeding activity is most intense from December to June. In locations where water temperature does not vary considerably with season, breeding can take place throughout the year. Breeding is assumed to peak during the summer in these locations, but common surgeon in these areas have spawning episodes throughout the year.

During months of prime temperature, females release their eggs about once a month. With each spawning event, females can release up to 40,000 eggs into the water column. High quantities of eggs and sperm make water cloudy in appearance.

Eggs of common surgeon hatch in 25 to 28 hours (average 26 hours). Larvae develop quickly and feed in great numbers off shore. Sexual maturity is not measured by age but rather by size. Males generally reach sexual maturity around 11 cm in length. Females, however, do not reach sexual maturity until about 13 cm in length.

Breeding interval: Common surgeon are believed to breed once monthly

Breeding season: Common surgeon generally breed during cooler months, from winter to early spring.

Average number of offspring: 40,000 eggs per spawning session.

Range time to hatching: 25 to 28 hours.

Average time to hatching: 26 hours.

Range time to independence: 4 to 7 days.

Average time to independence: 5 days.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

There is no parental investment among common surgeon. As broadcast spawners, males and females disperse after releasing their gametes into the water column.

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paracanthurus hepatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACAGCTCTGAGCCTACTTATCCGAGCTGAACTTAGCCAACCAGGGGCTCTCCTTGGAGATGATCAAATTTATAATGTAATCGTTACAGCGCATGCATTTGTAATGATTTTCTTTATAGTTATACCAATCATGATCGGAGGGTTCGGAAATTGACTCATCCCACTAATGATTGGGGCCCCTGATATAGCATTCCCGCGAATAAATAATATGAGCTTCTGACTTCTCCCACCATCCTTCCTTCTTCTCCTTGCCTCATCAGGCGTTGAAGCTGGAGCTGGTACGGGATGGACAGTTTACCCTCCTCTAGCAGGTAATTTAGCACATGCAGGGGCATCCGTAGATTTAACTATTTTTTCTCTCCACTTAGCAGGAATTTCCTCAATTCTAGGGGCTATTAACTTCATTACAACTATTATTAACATGAAACCCCCTGCTATTTCACAGTACCAAACCCCTCTGTTCGTCTGGGCAGTCTTGATTACAGCCGTTTTACTACTTCTCTCCCTCCCAGTCCTTGCTGCCGGGATCACAATACTCCTCACAGACCGAAATTTAAATACTACATTCTTCGACCCCGCAGGAGGGGGAGATCCTATTCTTTACCAGCATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Paracanthurus hepatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
McIlwain, J., Choat, J.H., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Paracanthurus hepatus is widespread in the Indo-Pacific and is relatively rare in most of its range. It is a targeted aquarium species. There are no indications of any population declines due to harvesting and no clear trends of catch information over time. It is found in numerous marine protected areas in parts of its distribution. It is therefore listed as Least Concern. We recommend further monitoring of the harvest levels and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common surgeon have not been evaluated by the IUCN, the US Fish and Wildlife Service, or CITES. Nevertheless, human activities have negatively impacted the habitat of most coral reef inhabitants.

Common surgeon are popular in the aquarium trade, and have been harvested for this purpose for many years. Although overfishing has affected wild populations, common surgeon are not yet considered threatened.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Paracanthurus hepatus is a targeted aquarium species in the Solomon Islands. Total purchases from Rarumana from 2002 to May 2004 were recorded at 7,697 individuals. In Vonavona Lagoon, purchases of this species were recorded at 5,568 individuals (Kinch 2004). It was recorded as occasional in terms of relative abundance in the northern Bismarck Sea, Papua New Guinea and in Raja Ampat, Indonesia (Allen 2009, 2003b). It is occasional in the American Samoa National Park (National Park of Samoa Checklist of Fishes accessed 21 April 2010). It is occasional in Tubbataha (Conales, S., Jr. pers. comm. 2010) and generally rare in most of the Philippines (R. Abesamis and C. Nanola pers. comm. 2010) and in Guam (J. McIlwain pers. comm. 2010). It is relatively common in Christmas Island and rare elsewhere in Australian waters.

On the reef systems of Tanzania, mean density was recorded at 0.63 per 500 m2 (McClanahan et al. 1999). It is the 8th most traded species worldwide. 74,557 individuals were traded from1997-2002 (Global Marine Aquarium Database accessed 19 March 2010).

Kinch (2004) estimated CPUE rate for aquarium fish at Rarumana, Solomon Islands at one fish caught per minute. Juvenile blue tangs are the main size group targeted, and are easy to collect as they school on certain Acropora spp. for shelter.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Overexploitation and destructive fishing practices are threats in some parts of its range (Kinch 2004, Reksodihardjo-Lilley and Lilley 2007).

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The venomous caudal spine of common surgeon can inflict painful but minor wounds on humans. There are no other known adverse effects of common surgeon on humans.

Negative Impacts: injures humans (poisonous , venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Common surgeon are common in the pet trade. After the release of the movie, "Finding Nemo", popularity for the species increased. Also known as regal tang, blue tang, blue hippo tang or the blue or palette surgeonfish, this species retails from $30 to well over $100 USD for breeding pairs.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Paracanthurus

Paracanthurus hepatus is a species of Indo-Pacific surgeonfish. A popular fish in marine aquaria, it is the only member of the genus Paracanthurus.[1][2] A number of common names are attributed to the species, including regal tang, palette surgeonfish, blue tang (leading to confusion with the Atlantic Acanthurus coeruleus), royal blue tang, hippo tang, flagtail surgeonfish, Pacific regal blue tang and blue surgeonfish.

Description[edit]

Paracanthurus hepatus has a royal blue body, yellow tail, and black 'palette' design. The lower body is yellow in the west-central Indian Ocean.[3] It grows to 30 cm (12 in.).[1] This fish is rather flat, like a pancake, with a circular body shape, a pointed snout-like nose, and small scales. The blue tang has 9 dorsal spines, 26-28 dorsal soft rays, 3 anal spines, and 24-26 anal soft rays.

Ecology[edit]

The species' range is broad, but it is common nowhere. It can be found throughout the Indo-Pacific. It is seen in reefs of East Africa, Japan, Samoa, New Caledonia, and the Great Barrier Reef.[1] The Blue tang is one of the most common and most popular marine aquarium fish all over the world. They live in pairs, or in a small groups of up to 10 or 12 individuals. These fish reach sexual maturity at 9-12 months of age.

The blue tang is ranked LC (least concern) by the World Conservation Union (IUCN), but is of low vulnerability.[1]

Diet[edit]

As a juvenile, its diet consists primarily of plankton. Adults are omnivorous and feed on plankton, but will also graze on algae. Spawning occurs during late afternoon and evening hours. This event is indicated by a change in color from a uniform dark blue to a pale blue.

Life cycle[edit]

Males aggressively court female members of the school, leading to a quick upward spawning rush toward the surface of the water during which eggs and sperm are released. The eggs are small, approximately 0.8 mm in diameter. The eggs are Pelagic, each containing a single droplet of oil for flotation. The fertilized eggs hatch in twenty-four hours, revealing small, translucent larvae with silvery abdomens and rudimentary caudal spines. Blue tangs can also, when faced with danger or dark spaces, make themselves semi-transparent, in order to help with evasion and light passivity, respectively.

Importance to humans[edit]

The blue tang is of minor commercial fisheries importance, however, it is a bait fish. The flesh has a strong odor and is not highly prized. This fish may cause ciguatera poisoning if consumed by humans. However, blue tangs are collected commercially for the aquarium trade. Handling the tang risks the chances of being badly cut by the caudal spine. These spines, on both sides of the caudal peduncle, are extended from the body when the fish becomes excited. The quick, thrashing sideways motion of the tail can produce deep wounds that result in swelling and discoloration, posing a risk of infection. It is believed that some species of Acanthurus have venom glands while others do not. The spines are used only as a method of protection against aggressors.[citation needed]

Aquarium life[edit]

The regal tang is commonly found in the aquarium trade, despite being one of the more fragile popular fish. In particular, it needs a source of spirulina to regularly graze from, and achieves a respectable size of 30cm (12 inches). In addition, it is prone to parasitic infections and lateral line disease.[4]

Paracanthurus hepatus in a home aquarium

Popular culture[edit]

In the 2003 Disney/Pixar film, Finding Nemo and its 2016 sequel, Finding Dory, the character Dory (voiced by Ellen DeGeneres) is a blue tang.

Bibliography[edit]

References[edit]

  1. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2007). "Paracanthurus hepatus" in FishBase. March 2007 version.
  2. ^ "Paracanthurus hepatus". Integrated Taxonomic Information System. Retrieved 21 March 2007. 
  3. ^ Debelius, H. 1993./> Indian Ocean Tropical Fish Guide. Aquaprint Verlags GmbH. ISBN 3-927991-01-5
  4. ^ Fenner, Robert. "Paracanthus FAQ". Retrieved 25 May 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!