Overview

Comprehensive Description

Biology

Found in protected coastal reef in mixed algae and coral habitat (Ref. 48635). Common on inshore coastal reefs but absent in clear offshore reefs (Ref. 9710). Juveniles have a demersal existence in shallow water in reef habitats, especially around coral rubble (Ref. 27259). Migrate over short distances to spawn, forming aggregations (Ref. 6390). May move into shallow water to feed (Ref. 6390). Eggs float just below the water surface (Ref. 6390). Pelagic larvae are found in habitats similar to those of the adults (Ref. 27260). Juveniles feed on small fish and invertebrates such as crustaceans and squid (Ref. 27261). Commonly used for food. Its flesh is delicate and well appreciated (Ref. 5503). Solitary (Ref 90102).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Plectropomus maculatus is known only from the western tropical Pacific: Thailand, Singapore, Philippines, Indonesia, Papua New Guinea, Solomon Islands, and Australia (Western Australia to southern Queensland). The species was formerly listed for the western Indian Ocean (Heemstra and Randall 1984) due to a misidentification of P. pessuliferus (Heemstra and Randall 1993).

West Thailand-Myanmar, Bintan, Sumatra, Seribu, Java Bali, Malay/Singapore, east Indonesia, Togean Islands, Suluwasei, Ambon, Halimahera, Flores, Komodo Sunda Islands, Raja Ampat, West Papua, Philippines, Solomon Islands; northwest Australia, Great Barrier Reef, South Taiwan, Micronesia, and Palau.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Thailand, Singapore, Philippines, Indonesia, Papua New Guinea, the Arafura Sea (Ref. 9819), Solomon Islands, and Australia (from Houtman Abrolhos in Western Australia to Gladstone, Queensland) (Ref. 3150). This species was formerly listed as occurring in the western Indian Ocean based on a misidentification of Plectropomus pessuliferus.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

125 cm TL (male/unsexed; (Ref. 90102)); max. published weight: 25.0 kg (Ref. 5222)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1000 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by red, pale grey or olive to dark brown color; head, body and fins with numerous small blue spots; small juveniles (under 5 cm) grey brown on back with scattered dark spots, broad, white midlateral stripe from upper pectoral base to basal portion of caudal fin, pair of dark stripes on central portion of caudal fin; front of jaws with pair of large canine teeth; 1-4 canines on side of lower jaw; body elongate, greatest depth 2.9-3.9 in SL; emarginate caudal fin; pectoral fins 1.8-2.2 in head length; pelvic fins 1.7-2.1 in head length (Ref. 90102).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Common on coastal reefs. Commonly used for food.
  • Smith, J.L.B. & M.M. Smith (1963). The fishes of Seychelles. Department of Ichthyology, Rhodes University. Grahamstown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
P. maculatus inhabits largely coastal and inshore reefs contrasting with other species of Plectropomus that are mainly associated with offshore and oceanic reefs. Turbid water and coastal habitats have resulted in relatively few abundance estimates. The depth of capture is typically from 5 to 50 m.

Reproduction
The reproductive biology of this species is complex (Brown et al. 1991). Adams (2002) concluded this species was a diandric protogynous hermaphrodite after sampling 104 individuals from the northern Great Barrier Reef. Histological examination revealed immature males with a primary testis configuration at one year of age, transitional gonads in females five to six years of age and the presence of females with precursory sperm sinuses. The operation sex ratio in the sample collection was 3.1F:1.0M. Maximum age of females was six years, males ten years suggesting all females changed sex. No evidence of large long-lived females was collected.

The most important aspect of the reproductive biology is the evidence for hybridization between P. leopardus and P. maculatus on the east coast of Australia (Frisch and van Herwerden 2006, van Herwerden et al. 2006). Analyses in van Herwerden et al. (2006) suggest that P. leopardus females have hybridized historically with P. maculatus males and that P. maculatus mitochondria were displaced through introgressive hybridization and fixation in the P. maculatus founder population on the Great Barrier Reef. Both species co-occur on mid shelf reefs of the east coast but not on the west coast where hybridization has not been recorded. It is unknown if hybridization occurs at any other localities where these two species co-occur.

Age and growth
Ferreira and Russ (1992) aged 103 individuals. Tmax was 12 years with L max 710 mm FL , Linf 732 mm Fl, K 2.1, Z 0.39. The median size of the sample was 370 mm FL and median age of 4 yrs. P. maculatus is relatively fast growing with males achieving a greater growth rate than females (Adams and William 2001). Adams (2002) estimated age based reproductive parameters with 50% female maturity at 18 months and 300 mm FL. No age-based data is available from other regions.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 5 - 100 m (Ref. 6390)
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 323 specimens in 1 taxon.
Water temperature and chemistry ranges based on 159 samples.

Environmental ranges
  Depth range (m): 5 - 91
  Temperature range (°C): 23.446 - 28.897
  Nitrate (umol/L): 0.057 - 6.383
  Salinity (PPS): 32.279 - 35.411
  Oxygen (ml/l): 3.725 - 4.734
  Phosphate (umol/l): 0.091 - 0.557
  Silicate (umol/l): 0.567 - 9.429

Graphical representation

Depth range (m): 5 - 91

Temperature range (°C): 23.446 - 28.897

Nitrate (umol/L): 0.057 - 6.383

Salinity (PPS): 32.279 - 35.411

Oxygen (ml/l): 3.725 - 4.734

Phosphate (umol/l): 0.091 - 0.557

Silicate (umol/l): 0.567 - 9.429
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 100m.
From 5 to 100 meters.

Habitat: reef-associated. Roving grouper. Attains at least 90 cm. Brownish orange-red with well separated dark edged blue spots, some of which are usually elongate. Tail margin white.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found inshore (Ref. 75154).
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plectropomus maculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTCGGGACCGCTCTAAGCCTACTTATTCGGGCAGAGCTTAGTCAACCCGGTGCTCTTTTAGGAGACGACCAAATCTATAACGTGATTGTTACCGCACACGCATTTGTAATAATCTTTTTTATAGTAATACCAATCATAATTGGAGGCTTCGGAAATTGACTTATTCCTCTAATGATCGGCGCCCCCGATATAGCATTCCCTCGAATAAACAATATGAGCTTCTGACTTCTACCTCCTTCTTTTCTTCTCCTTCTAGCCTCATCCGGAGTTGAAGCAGGTGCTGGGACAGGATGAACAGTTTATCCTCCTCTAGCAGGAAACCTGGCCCATGCAGGTGCATCCGTAGACTTAACAATCTTTTCACTTCACTTAGCGGGTATCTCATCAATTCTTGGAGCAATTAACTTTATTACTACTATTATCAACATGAAACCCCCTGCTATCTCCCAATACCAGACCCCCCTGTTCGTATGAGCAGTCCTAATTACTGCGGTTCTTCTTCTCCTATCACTACCTGTTCTGGCTGCTGGAATTACAATACTATTAACCGACCGAAACCTCAACACTACCTTCTTTGACCCTGCTGGAGGAGGAGATCCAATTCTCTACCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plectropomus maculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Choat, J.H., Sadovy, Y., Craig, M.T., Ferreira, B. & Rocha, L.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Plectropomus maculatus is wide-spread and locally abundant with protective measures in places with greatest abundance (Australia). It is heavily fished in the Southeast Asian part of its range, but there is very little information, and overall, the global population is unlikely to be declining at a rate close to 30%. Therefore, the species is currently listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
As with P. leopardus, the main area of abundance is on the Australian plate.

Fisheries-independent data
Halford (Indonesia) and Hamilton (Solomons PNG) report (pers. comm.) report this species as rare to uncommon during underwater surveys. The main species of Plectropomus encountered in these surveys was P. areolatus. Occurrence records and abundance estimates show a characteristic onshore to offshore decline in abundance in this species. The summary of a comprehensive analysis of the distribution and abundance of four species of Plectropomus of the NE coast of Australia and the Coral Sea (Ayling and Ayling 1986) is provided in Table 1.

Follow the link below for Table 1.

There appear to be few estimates of abundance of this species in the Indonesian and Philippine archipelagos. As with P. leopardus, this species appears to be relatively rare at low latitudes and achieves its greatest abundance in inshore reef habitats on the Australian plate.

Not recorded on offshore Western Australia reefs. (Done et al. 1994)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
P. maculatus is subject to fishing over most of it’s range including the Live Reef Fish Trade (LRFT). Was the 4th most abundant serranid recorded in a survey of the NW Australia coastal trap and line fishery (Moran et al. 1988). Commercially fished over much of its range for both local consumption and the LRFT (Lau and Li 2000). Records of capture may be difficult to interpret as this species is usually lumped with P. leopardus in the east Australian fishery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
P. maculatus is presently protected in eastern Australia by the GBRMPA marine park zoning system (Russ pers comm.) has reported a 20% increase in three years in coastal MPAs on the Great Barrier Reef relative to open reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • Jonklaas, R. 1975 Collecting marine tropicals. T.F.H. Publications, Neptune City, USA. 224 p. (Ref. 10361)
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!