Overview

Comprehensive Description

Biology

Maximum TL recorded: 48.5 cm (Ref. 2801). Occurs in flowing rivers; consumed as food (Ref. 11970).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

L. annectens ZBK :

CU 83154; CU 86343; CU 86392.

  • Sinaseli M. Tshibwabwa, Melanie L. J. Stiassny, Robert C. Schelly (2006): Description of a new species of Labeo (Teleostei: Cyprinidae) from the lower Congo River. Zootaxa 1224, 33-44: 35-35, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:432790D3-8DEE-4499-816C-9C1963BAE14E
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Labeo annectens is known from throughout the Congo River basin. It is also known from the Lower Guinea region where it is widely distributed in most basins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: principal coastal rivers of southern Cameroon to Cabinda, and from the Congo River basin (Ref. 26192).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 910; Vertebrae: 31 - 33
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

17.5 cm SL (male/unsexed; (Ref. 81639))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 485 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: snout rounded and prominent, usually with deep transverse furrow and very well-developed fleshy appendage at its anterior end (Ref. 26190, 81639). Scale formula: 38-39 (38 commonly observed); 4.5-5.5 (5.5 commonly observed); 3.0-3.5 (3.0 commonly observed); 14-16 (16 commonly observed); dorsal fin with 9-10 (10 commonly observed) branched rays (Ref. 81639). Upper edge of dorsal fin always concave (Ref. 26190, 81639). 31-33 (33 commonly observed) vertebrae; ventral fin origin located under the 4th branched dorsal ray; genital opening distal from anal fin origin; dark brown longitudinal band on flanks, not flared over scaled base of caudal fin (Ref. 81639). Description: eye relatively small and supero-laterally positioned (Ref. 26190, 81639. Longest dorsal fin ray 20.2-36.1% SL; caudal peduncle narrow, depth 11.6-17.3% SL (Ref. 81639). Coloration: in preservation, brown or dark brown above lateral line, beige or light brown ventrally; dark longitudinal band always present but less clearly defined in large individuals (Ref. 81639).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Labeo annectens is a benthopelagic species that occurs in flowing rivers.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labeo annectens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACCTCGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTTCTCATCCGTGCTGAACTAAGCCAACCCGGATCGCTTCTAGGTGACGACCAAATTTATAATGTTATCGTAACTGCTCACGCCTTCGTAATAATTTTCTTTATAGTTATGCCCGTCCTCATTGGAGGATTTGGAAACTGGCTCGTACCATTAATGATCGGGGCCCCAGACATGGCATTCCCTCGTATAAATAACATAAGCTTCTGACTCCTACCCCCATCATTCCTACTACTGCTAGCCTCTTCTGGTGTTGAAGCTGGGGCTGGAACAGGATGAACAGTATACCCTCCTCTTGCTAGTAACCTAGCCCACGCAGGGGCATCAGTAGACCTAACAATTTTCTCACTCCACCTAGCAGGTGTCTCATCAATTCTAGGGGCTATTAATTTTATTACTACAACCATTAACATGAAACCCCCAGCCATTTCACAATATCAAACTCCCCTATTCGTCTGATCCGTGCTTGTAACCGCCGTACTACTTCTCCTATCACTACCAGTACTAGCAGCGGGTATCACAATGCTTTTAACAGATCGAAATCTTAATACCACATTCTTCGACCCGGCAGGAGGAGGAGACCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo annectens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Moelants, T.

Reviewer/s
Brummett, R., Mbe Tawe, A.N., Dening Touokong, C., Reid, G.M., Snoeks, J. Staissny, M., Moelants, T., Mamonekene, V., Ndodet, B., Ifuta, S.N.B., Chilala, A., Monsembula, R., Ibala Zamba, A., Opoye Itoua, O., Pouomogne, V., Darwall, W. & Smith, K.

Contributor/s

Justification
The species is widespread or without major threats throughout central Africa and is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Labeo annectens

Labeo annectens is a species of fish in the family Cyprinidae, the carps and minnows. It is native to central Africa, where it occurs in several river basins, including the Congo River basin.[1]

This fish is known to reach a maximum length of 48.5 centimeters. It has a long, rounded snout with a fleshy appendix at the end.[2]

This species is a food fish.[2] It is widespread and not considered threatened.[1]

References[edit]

  1. ^ a b Moelants, T. 2010. Labeo annectens. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Downloaded on 16 October 2013.
  2. ^ a b Froese, R. and D. Pauly. (Eds.) Labeo annectens. FishBase. 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!