Overview

Comprehensive Description

Biology

Occurs in flowing rivers. Consumed as food (Ref. 11970).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa: principal coastal rivers of southern Cameroon to Cabinda and from the Congo River basin. Also found in the Luongo River, Congo system, Zambia (Ref. 27609).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Labeo annectens is known from throughout the Congo River basin. It is also known from the Lower Guinea region where it is widely distributed in most basins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10; Vertebrae: 31 - 33
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 485 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

48.5 cm TL (male/unsexed; (Ref. 2801))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal fin concave; snout rounded and prominent with transverse furrow and a fleshy appendix at the end; eye relatively small in superolateral position; genital orifice far from the origin of the anal fin; lateral band normal (Ref. 26190).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Labeo annectens is a benthopelagic species that occurs in flowing rivers.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labeo annectens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACCTCGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTTCTCATCCGTGCTGAACTAAGCCAACCCGGATCGCTTCTAGGTGACGACCAAATTTATAATGTTATCGTAACTGCTCACGCCTTCGTAATAATTTTCTTTATAGTTATGCCCGTCCTCATTGGAGGATTTGGAAACTGGCTCGTACCATTAATGATCGGGGCCCCAGACATGGCATTCCCTCGTATAAATAACATAAGCTTCTGACTCCTACCCCCATCATTCCTACTACTGCTAGCCTCTTCTGGTGTTGAAGCTGGGGCTGGAACAGGATGAACAGTATACCCTCCTCTTGCTAGTAACCTAGCCCACGCAGGGGCATCAGTAGACCTAACAATTTTCTCACTCCACCTAGCAGGTGTCTCATCAATTCTAGGGGCTATTAATTTTATTACTACAACCATTAACATGAAACCCCCAGCCATTTCACAATATCAAACTCCCCTATTCGTCTGATCCGTGCTTGTAACCGCCGTACTACTTCTCCTATCACTACCAGTACTAGCAGCGGGTATCACAATGCTTTTAACAGATCGAAATCTTAATACCACATTCTTCGACCCGGCAGGAGGAGGAGACCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labeo annectens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Moelants, T.

Reviewer/s
Brummett, R., Mbe Tawe, A.N., Dening Touokong, C., Reid, G.M., Snoeks, J. Staissny, M., Moelants, T., Mamonekene, V., Ndodet, B., Ifuta, S.N.B., Chilala, A., Monsembula, R., Ibala Zamba, A., Opoye Itoua, O., Pouomogne, V., Darwall, W. & Smith, K.

Contributor/s

Justification
The species is widespread or without major threats throughout central Africa and is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Labeo annectens

Labeo annectens is fish in genus Labeo found in Africa.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!