Overview

Distribution

Western Indian Ocean: Mozambique and South Africa to Reunion and Mauritius.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Indian Ocean: East Africa and South Africa, western Mascarenes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

8.6 cm SL (male/unsexed; (Ref. 28618))
  • Randall, J.E. 1997 Randall's tank photos. Collection of 10,000 large-format photos (slides) of dead fishes. Unpublished. (Ref. 28618)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 15 m (Ref. 33390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1 - 6
  Temperature range (°C): 27.233 - 28.380
  Nitrate (umol/L): 0.061 - 0.294
  Salinity (PPS): 34.667 - 34.992
  Oxygen (ml/l): 4.498 - 4.680
  Phosphate (umol/l): 0.162 - 0.226
  Silicate (umol/l): 3.321 - 4.966

Graphical representation

Depth range (m): 1 - 6

Temperature range (°C): 27.233 - 28.380

Nitrate (umol/L): 0.061 - 0.294

Salinity (PPS): 34.667 - 34.992

Oxygen (ml/l): 4.498 - 4.680

Phosphate (umol/l): 0.162 - 0.226

Silicate (umol/l): 3.321 - 4.966
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canthigaster natalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAACTCAGCCAACCCGGCGCACTTCTAGGTGACGACCAAATTTATAATGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGCGGCTTTGGAAACTGGCTAGTGCCCCTTATAATTGGAGCACCCGACATGGCATTCCCTCGAATAAATAATATAAGTTTCTGACTGCTACCCCCCTCCTTCCTACTCCTCCTGGCATCTTCCGGCGTAGAAGCCGGGGCTGGCACAGGCTGAACAGTCTACCCACCACTAGCAGGCAACCTAGCCCACGCAGGAGCCTCTGTCGACCTCACAATTTTCTCTCTCCACCTAGCAGGTGTTTCATCAATTCTAGGCGCTATCAACTTTATTACTACAATTATTAACATGAAACCCCCAGCCATCTCTCAATATCAAACCCCGCTCTTCGTATGGGCTGTCCTAATCACTGCTGTCCTGCTACTGTTATCACTACCAGTTCTCGCAGCCGGAATTACAATACTTCTCACAGACCGAAACCTAAACACCACCTTTTTTGACCCTGCGGGAGGAGGAGACCCCATTCTTTATCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Canthigaster natalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!