Overview

Comprehensive Description

Biology

Adults inhabit rocky shores exposed to wave action. Often in tide pools. Feed primarily on algae and detritus. Territorial and pugnacious. Generally common (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Taken incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Central Atlantic: Florida, Gulf of Mexico, Caribbean Sea and along the coast of central America to Panama and Venezuela. Also known from the Bahamas and the Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 14 - 17; Analspines: 2; Analsoft rays: 13 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

15.0 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Juveniles are reddish orange above, with small bright blue spots on forehead and dark spots at upper pectoral fin base, dorsal fin, and caudal peduncle; colors disappear as fish grows larger (Ref. 26938). Adults dark gray to blackish with vertical black lines on body; a black spot, sometimes diffuse, at upper base of pectoral fins which are pale; other fins dark (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Stegastes adustus
Catalog Number: USNM 170923
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1932
Locality: B.W.I., Antigua, Tide Pool In Deep Bay, Antigua, Leeward Islands, Antigua and Barbuda, Lesser Antilles, Caribbean Sea, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Stegastes adustus
Catalog Number: USNM 170922
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1932
Locality: B.W.I., Grenadines, Union Is., Near Shore In Chatham Bay, Union Island, Windward Islands, Saint Vincent and the Grenadines, Lesser Antilles, Caribbean Sea, Atlantic
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 3 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 107 specimens in 1 taxon.
Water temperature and chemistry ranges based on 82 samples.

Environmental ranges
  Depth range (m): 0.225 - 43
  Temperature range (°C): 26.770 - 28.035
  Nitrate (umol/L): 0.161 - 2.722
  Salinity (PPS): 34.217 - 36.481
  Oxygen (ml/l): 4.519 - 4.694
  Phosphate (umol/l): 0.051 - 0.176
  Silicate (umol/l): 1.925 - 3.502

Graphical representation

Depth range (m): 0.225 - 43

Temperature range (°C): 26.770 - 28.035

Nitrate (umol/L): 0.161 - 2.722

Salinity (PPS): 34.217 - 36.481

Oxygen (ml/l): 4.519 - 4.694

Phosphate (umol/l): 0.051 - 0.176

Silicate (umol/l): 1.925 - 3.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits rocky shores exposed to wave action. Often in tide pools. Feeds primarily on algae and detritus. Territorial and pugnacious. Territorial herbivore (Ref. 57616). Generally common (Ref. 9710). Taken incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes adustus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCTCTAAGTCTCCTCATTCGGGCAGAACTAAGCCAACCCGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATTGTTACGGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATCGGGGCCCCCGACATGGCCTTTCCCCGAATAAACAATATAAGCTTCTGACTTCTCCCCCCTTCCTTTCTTCTTCTGCTTGCCTCTTCAGGTGTAGAAGCAGGTGCAGGAACAGGATGAACAGTCTACCCTCCACTATCTGGCAACCTAGCTCATGCAGGGGCCTCCGTTGACCTAACCATTTTCTCCCTTCATCTAGCAGGAATTTCATCGATCCTAGGAGCAATCAACTTTATCACTACTATTATTAACATGAAGCCCCCTTCTATCTCTCAATACCAAACCCCTCTCTTTGTATGAGCAGTTCTAATCACCGCCGTACTACTACTCCTCTCCCTTCCCGTCTTAGCTGCCGGTATTACTATGCTCCTAACGGACCGAAACCTTAATACTACTTTCTTTGACCCTGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes adustus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Stegastes adustus

Stegastes adustus, commonly called the dusky damselfish or scarlet-backed demoiselle, is a damselfish of the family Pomacentridae. It is found at one- to three-meter depths on surging and wavy coral reefs in the Caribbean Sea, the tropical waters of the western Atlantic Ocean, and the Gulf of Mexico.

Adults feed on plants and detritus.

References

Froese, Rainer, and Daniel Pauly, eds. (2008). "Stegastes adustus" in FishBase. December 2008 version.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!