Overview

Comprehensive Description

Biology

Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Belize, Isla de Providencia, Lesser Antilles.
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Longer snout than Pug-nosed pipefish.
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Bryx randalli
Catalog Number: USNM 198903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1965
Locality: Venezuela: S. Side of Isla Venados, W. of Cumana., Venezuela, Caribbean Sea, Atlantic
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 7.75 - 28
  Temperature range (°C): 27.274 - 27.654
  Nitrate (umol/L): 0.336 - 1.786
  Salinity (PPS): 35.410 - 36.041
  Oxygen (ml/l): 4.616 - 4.687
  Phosphate (umol/l): 0.075 - 0.093
  Silicate (umol/l): 1.960 - 2.021

Graphical representation

Depth range (m): 7.75 - 28

Temperature range (°C): 27.274 - 27.654

Nitrate (umol/L): 0.336 - 1.786

Salinity (PPS): 35.410 - 36.041

Oxygen (ml/l): 4.616 - 4.687

Phosphate (umol/l): 0.075 - 0.093

Silicate (umol/l): 1.960 - 2.021
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bryx randalli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAGTATTTGGTGCATGAGCTGGCATAGTTGGTACTGCACTCAGCCTTTTAATTCGGACAGAACTTAGCCAGCCTGGGGCTTTATTGGGTGATGATCAAATTTATAATGTAATTGTCACCGCCCATGCATTCGTAATAATCTTCTTTATGGTTATACCTATCATGATTGGAGGTTTTGGTAACTGACTAATTCCTCTAATAATTGGTGCCCCAGATATAGCCTTTCCTCGAATAAATAATATGAGCTTCTGACTCTTGCCCCCATCCTTTCTTCTTCTCCTCGCTTCATCAGGTGTTGAAGCCGGTGCAGGTACAGGATGAACAGTTTATCCTCCTCTAGCGGGCAACCTAGCCCATGCGGGAGCTTCAGTTGATTTAACAATTTTTTCCCTACATTTGGCAGGAGTTTCCTCAATTTTAGGTGCTATTAATTTTATTACCACTATCATCAACATAAAACCTCCCTCTACCTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTACTAATTACAGCTGTTCTACTCTTACTTTCTCTACCTGTTCTAGCAGCTGGTATTACAATACTACTTACCGATCGTAATTTAAACACAACCTTTTTTGACCCGGCGGGAGGAGGAGACCCGATCCTGTATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bryx randalli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!