Overview

Comprehensive Description

Biology

Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Belize, Isla de Providencia, Lesser Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Longer snout than Pug-nosed pipefish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Bryx randalli
Catalog Number: USNM 198903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1965
Locality: Venezuela: S. Side of Isla Venados, W. of Cumana., Venezuela, Caribbean Sea, Atlantic
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 7.75 - 28
  Temperature range (°C): 27.274 - 27.654
  Nitrate (umol/L): 0.336 - 1.786
  Salinity (PPS): 35.410 - 36.041
  Oxygen (ml/l): 4.616 - 4.687
  Phosphate (umol/l): 0.075 - 0.093
  Silicate (umol/l): 1.960 - 2.021

Graphical representation

Depth range (m): 7.75 - 28

Temperature range (°C): 27.274 - 27.654

Nitrate (umol/L): 0.336 - 1.786

Salinity (PPS): 35.410 - 36.041

Oxygen (ml/l): 4.616 - 4.687

Phosphate (umol/l): 0.075 - 0.093

Silicate (umol/l): 1.960 - 2.021
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bryx randalli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAGTATTTGGTGCATGAGCTGGCATAGTTGGTACTGCACTCAGCCTTTTAATTCGGACAGAACTTAGCCAGCCTGGGGCTTTATTGGGTGATGATCAAATTTATAATGTAATTGTCACCGCCCATGCATTCGTAATAATCTTCTTTATGGTTATACCTATCATGATTGGAGGTTTTGGTAACTGACTAATTCCTCTAATAATTGGTGCCCCAGATATAGCCTTTCCTCGAATAAATAATATGAGCTTCTGACTCTTGCCCCCATCCTTTCTTCTTCTCCTCGCTTCATCAGGTGTTGAAGCCGGTGCAGGTACAGGATGAACAGTTTATCCTCCTCTAGCGGGCAACCTAGCCCATGCGGGAGCTTCAGTTGATTTAACAATTTTTTCCCTACATTTGGCAGGAGTTTCCTCAATTTTAGGTGCTATTAATTTTATTACCACTATCATCAACATAAAACCTCCCTCTACCTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTACTAATTACAGCTGTTCTACTCTTACTTTCTCTACCTGTTCTAGCAGCTGGTATTACAATACTACTTACCGATCGTAATTTAAACACAACCTTTTTTGACCCGGCGGGAGGAGGAGACCCGATCCTGTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bryx randalli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!