Overview

Comprehensive Description

Biology

Occur over muddy bottoms of the continental shelf (Ref. 4340), from estuaries to coastal beaches and to relatively deep waters (less than 122 m) (Ref. 57343). Forms loosely-associated schools (Ref. 57343). Feeds on small crustaceans, fishes and other benthic organisms (Ref. 30573). Fish of 12 cm can be caught in large numbers (Ref. 9685).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Philippines, Society Islands and Marquesas Islands, north to southern Japan, south to Western Australia, Port Stephens (New South Wales), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to French Polynesia, north to Japan, south to Australia. Has not been collected from the Red Sea or Persian Gulf (Ref. 57343).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

FAO fishing area 51, FAO fishing area 57, FAO fishing area 61, FAO fishing area 71, FAO fishing area 77, FAO fishing area 81, Kenya, Madagascar, Mauritius, Mozambique, New Hebrides, Reunion, Society Islands, Somalia, South Africa (country), Tahiti, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Philippines, Society Islands and Marquesas Islands, north to southern Japan, south to Western Australia, Port Stephens (New South Wales), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 13; Analspines: 2; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 450 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

45.0 cm SL (male/unsexed; (Ref. 57343)); max. published weight: 1,650 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Golden, dusky olive brown above, scale rows each with a dark line; fins dusky (Ref. 5492). Body with 7 or 8 prominent dark stripes along the longitudinal scale rows above lateral line and 7-9 faint stripes below. Pectoral fin rays unbranched; 4th or 5th pectoral filament longest, 22-40% of SL. Posterior margin of maxilla reaching to (or slightly extending beyond) level of posterior margin of adipose eyelid. Lower tip of 7th proximal pterygiophore of 1st dorsal fin directed backwards. Lateral squamation on caudal fin unbranched (Ref. 40970).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs over muddy bottoms of the continental shelf (Ref. 4340). Attains at least 45 cm SL (Ref. 9685). Fish of 12 cm can be caught in large numbers (Ref. 9685).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; brackish; marine; depth range ? - 122 m (Ref. 57343)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1 - 277
  Temperature range (°C): 26.151 - 27.540
  Nitrate (umol/L): 0.276 - 3.114
  Salinity (PPS): 35.924 - 36.032
  Oxygen (ml/l): 4.462 - 4.641
  Phosphate (umol/l): 0.228 - 0.546
  Silicate (umol/l): 1.386 - 4.277

Graphical representation

Depth range (m): 1 - 277

Temperature range (°C): 26.151 - 27.540

Nitrate (umol/L): 0.276 - 3.114

Salinity (PPS): 35.924 - 36.032

Oxygen (ml/l): 4.462 - 4.641

Phosphate (umol/l): 0.228 - 0.546

Silicate (umol/l): 1.386 - 4.277
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs over muddy bottoms of the continental shelf (Ref. 4340), and coastal waters (Ref. 9137). Feeds on small crustaceans, fishes and other benthic organisms (Ref. 30573).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Polydactylus plebeius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAATCTTCGGGGCCTGAGCCGGAATGGTGGGGACAGCCCTCAGCCTACTAATCCGTGCCGAGCTCAGCCAACCTGGCGCACTCCTAGGAGACGACCAGATTTATAATGTTATCGTCACCGCACATGCTTTTGTGATGATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGGAATTGACTTGTACCTCTAATAATTGGCGCCCCCGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTCCTCCCCCCCTCTTTCCTACTCCTCCTGGCATCATCAGGGGTAGAGGCCGGAGCAGGAACCGGCTGGACCGTCTACCCACCTTTAGCAGGCAACCTCGCCCACGCAGGAGCATCCGTTGACTTAACCATCTTCTCCCTTCACCTGGCAGGGGTGTCCTCAATTCTTGGGGCCATCAACTTTATTACAACAATTTTTAACATAAAACCAGCCTCTGCCTCAATATACCAACTGCCCCTATTCGTCTGAGCCGTCCTAGTCACAGCTGTACTGCTCCTCTTATCCCTCCCTGTTCTAGCTGCTGGAATTACCATGCTACTAACGGACCGAAACCTAAACACTGCCTTCTTTGACCCTGCGGGCGGAGGCGATCCTGTCCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Polydactylus plebeius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!