Overview
Comprehensive Description
Biology
Occur over muddy bottoms of the continental shelf (Ref. 4340), from estuaries to coastal beaches and to relatively deep waters (less than 122 m) (Ref. 57343). Forms loosely-associated schools (Ref. 57343). Feeds on small crustaceans, fishes and other benthic organisms (Ref. 30573). Fish of 12 cm can be caught in large numbers (Ref. 9685).
-
Motomura, H. 2004 Threadfins of the world (Family Polynemidae). An annotated and illustrated catalogue of polynemid species known to date. FAO Spec. Cat. Fish. Purp. Rome: FAO. 3:117 p. (Ref. 57343)
http://www.fishbase.org/references/FBRefSummary.php?id=57343&speccode=340
Trusted
Distribution
Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Philippines, Society Islands and Marquesas Islands, north to southern Japan, south to Western Australia, Port Stephens (New South Wales), New Caledonia and Tonga.
Trusted
Indo-Pacific: East Africa to French Polynesia, north to Japan, south to Australia. Has not been collected from the Red Sea or Persian Gulf (Ref. 57343).
-
Feltes, R.M. 2001 Polynemidae. Threadfins. p. 3090-3116. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 5. Bony fishes part 3 (Menidae to Pomacentridae). FAO, Rome. (Ref. 9685)
http://www.fishbase.org/references/FBRefSummary.php?id=9685&speccode=13530
Trusted
FAO fishing area 51, FAO fishing area 57, FAO fishing area 61, FAO fishing area 71, FAO fishing area 77, FAO fishing area 81, Kenya, Madagascar, Mauritius, Mozambique, New Hebrides, Reunion, Society Islands, Somalia, South Africa (country), Tahiti, Tanzania
-
MacNae, W. & M. Kalk (eds) (1958). A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. I-iv, 163 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6266
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Kalk, M. (1958). The fauna of the intertidal rocks at Inhaca Island, Delagoa Bay. Ann. Natal Mus. 14: 189-242.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6229
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Letourneur, Y., M. Harmelin-Vivien & R. Galzin (1993). Impact of hurricane Firinga on fish community structure on fringing reefs of Reunion Island, S.W. Indian Ocean. Environmental Biology of Fishes 37: 109-120
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6048
-
Motomura, H. (2004). Threadfins of the world. An annotated and illustrated catalogue of polynemid species known to date. Family Polynemidae. FAO Species Catalogue for Fishery Purposes. No. 3. Rome, FAO. 117 p., 151 figs, 6 pls.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138595
Trusted
Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Philippines, Society Islands and Marquesas Islands, north to southern Japan, south to Western Australia, Port Stephens (New South Wales), New Caledonia and Tonga.
Trusted
Physical Description
Morphology
Dorsal spines (total): 9; Dorsal soft rays (total): 13; Analspines: 2; Analsoft rays: 11 - 12
-
Smith, M.M. 1986 Polynemidae. p. 720-721. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5492)
http://www.fishbase.org/references/FBRefSummary.php?id=5492&speccode=4469
Trusted
Size
Max. size
45.0 cm SL (male/unsexed; (Ref. 57343)); max. published weight: 1,650 g (Ref. 40637)
-
IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
http://www.fishbase.org/references/FBRefSummary.php?id=40637&speccode=943
-
Motomura, H. 2004 Threadfins of the world (Family Polynemidae). An annotated and illustrated catalogue of polynemid species known to date. FAO Spec. Cat. Fish. Purp. Rome: FAO. 3:117 p. (Ref. 57343)
http://www.fishbase.org/references/FBRefSummary.php?id=57343&speccode=340
Trusted
Diagnostic Description
Golden, dusky olive brown above, scale rows each with a dark line; fins dusky (Ref. 5492). Body with 7 or 8 prominent dark stripes along the longitudinal scale rows above lateral line and 7-9 faint stripes below. Pectoral fin rays unbranched; 4th or 5th pectoral filament longest, 22-40% of SL. Posterior margin of maxilla reaching to (or slightly extending beyond) level of posterior margin of adipose eyelid. Lower tip of 7th proximal pterygiophore of 1st dorsal fin directed backwards. Lateral squamation on caudal fin unbranched (Ref. 40970).
-
Smith, M.M. 1986 Polynemidae. p. 720-721. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5492)
http://www.fishbase.org/references/FBRefSummary.php?id=5492&speccode=4469
Trusted
Description
Occurs over muddy bottoms of the continental shelf (Ref. 4340). Attains at least 45 cm SL (Ref. 9685). Fish of 12 cm can be caught in large numbers (Ref. 9685).
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
demersal; brackish; marine; depth range ? - 122 m (Ref. 57343)
-
Motomura, H. 2004 Threadfins of the world (Family Polynemidae). An annotated and illustrated catalogue of polynemid species known to date. FAO Spec. Cat. Fish. Purp. Rome: FAO. 3:117 p. (Ref. 57343)
http://www.fishbase.org/references/FBRefSummary.php?id=57343&speccode=340
Trusted
Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 1 - 277
Temperature range (°C): 26.151 - 27.540
Nitrate (umol/L): 0.276 - 3.114
Salinity (PPS): 35.924 - 36.032
Oxygen (ml/l): 4.462 - 4.641
Phosphate (umol/l): 0.228 - 0.546
Silicate (umol/l): 1.386 - 4.277
Graphical representation
Depth range (m): 1 - 277
Temperature range (°C): 26.151 - 27.540
Nitrate (umol/L): 0.276 - 3.114
Salinity (PPS): 35.924 - 36.032
Oxygen (ml/l): 4.462 - 4.641
Phosphate (umol/l): 0.228 - 0.546
Silicate (umol/l): 1.386 - 4.277
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 1 - 277
Temperature range (°C): 26.151 - 27.540
Nitrate (umol/L): 0.276 - 3.114
Salinity (PPS): 35.924 - 36.032
Oxygen (ml/l): 4.462 - 4.641
Phosphate (umol/l): 0.228 - 0.546
Silicate (umol/l): 1.386 - 4.277
Graphical representation
Depth range (m): 1 - 277
Temperature range (°C): 26.151 - 27.540
Nitrate (umol/L): 0.276 - 3.114
Salinity (PPS): 35.924 - 36.032
Oxygen (ml/l): 4.462 - 4.641
Phosphate (umol/l): 0.228 - 0.546
Silicate (umol/l): 1.386 - 4.277
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Occurs over muddy bottoms of the continental shelf (Ref. 4340), and coastal waters (Ref. 9137). Feeds on small crustaceans, fishes and other benthic organisms (Ref. 30573).
-
Daget, J. and J.C. Njock 1986 Polynemidae. p. 352-354. In J. Daget, J.-P. Gosse and D.F.E. Thys van den Audenaerde (eds.) Check-list of the freshwater fishes of Africa (CLOFFA). ISNB, Brussels; MRAC, Tervuren; and ORSTOM, Paris. Vol. 2. (Ref. 4340)
http://www.fishbase.org/references/FBRefSummary.php?id=4340&speccode=341
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Polydactylus plebeius
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACCCTTTATTTAATCTTCGGGGCCTGAGCCGGAATGGTGGGGACAGCCCTCAGCCTACTAATCCGTGCCGAGCTCAGCCAACCTGGCGCACTCCTAGGAGACGACCAGATTTATAATGTTATCGTCACCGCACATGCTTTTGTGATGATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGGAATTGACTTGTACCTCTAATAATTGGCGCCCCCGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTCCTCCCCCCCTCTTTCCTACTCCTCCTGGCATCATCAGGGGTAGAGGCCGGAGCAGGAACCGGCTGGACCGTCTACCCACCTTTAGCAGGCAACCTCGCCCACGCAGGAGCATCCGTTGACTTAACCATCTTCTCCCTTCACCTGGCAGGGGTGTCCTCAATTCTTGGGGCCATCAACTTTATTACAACAATTTTTAACATAAAACCAGCCTCTGCCTCAATATACCAACTGCCCCTATTCGTCTGAGCCGTCCTAGTCACAGCTGTACTGCTCCTCTTATCCCTCCCTGTTCTAGCTGCTGGAATTACCATGCTACTAACGGACCGAAACCTAAACACTGCCTTCTTTGACCCTGCGGGCGGAGGCGATCCTGTCCTCTACCAACACCTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Polydactylus plebeius
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 17
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 17
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; aquaculture: commercial; gamefish: yes
-
Liao, C.-I., H.-M. Su and E.Y. Chang 2001 Techniques in finfish larviculture in Taiwan. Aquaculture 200(2001):1-31. (Ref. 40297)
http://www.fishbase.org/references/FBRefSummary.php?id=40297&speccode=1895
-
van der Elst, R. 1993 A guide to the common sea fishes of southern Africa. (3rd Ed.). Struik Publishers, Cape Town. 398 p. (Ref. 12484)
http://www.fishbase.org/references/FBRefSummary.php?id=12484&speccode=80
-
Motomura, H. 2004 Threadfins of the world (Family Polynemidae). An annotated and illustrated catalogue of polynemid species known to date. FAO Spec. Cat. Fish. Purp. Rome: FAO. 3:117 p. (Ref. 57343)
http://www.fishbase.org/references/FBRefSummary.php?id=57343&speccode=340
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


