Overview

Comprehensive Description

Biology

Occurs in shallow lagoon and seaward reefs, primarily found in the surge zone (Ref. 9710). Benthic (Ref. 58302). Lives between rocks and corals.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: moray (English), morena (Espanol)
 
Gymnothorax buroensis (Bleeker, 1857)


Latticetail moray,     Vagrant moray

Stout bodied; tail a little > ½ TL; front nostrils tubular, rear nostrils a hole at upper profile level; teeth pointed, conical, not serrated; 2 rows of teeth on side top jaws, outer row smaller, 5 rows at front; lower jaw with 2 rows at front; dorsal and anal fins covered with skin, but clearly evident; dorsal fin origin before gill opening;



Light brown at front, finely spotted with dark brown; body with 5 rows of small dark brown blotches that tend to line up vertically forming diffuse bars, blotches larger at rear; margin of tail yellowish.


Size: reaches 47 cm.

Habitat: rocky bottoms.

Depth: 1-10 m.

Widespread in the tropical Indo-Pacific from East Africa to the Americas; in the eastern Pacific known from Costa Rica and western Panama, and Clipperton, Cocos and the Galapagos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Tuamoto Islands, north to the Ryukyu and Hawaiian islands. Eastern Central Pacific: Costa Rica and Panama (Ref. 9324) and the Galapagos (Ref. 2334).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Chagos, Comores, Madagascar, Mauritius, Reunion, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, KwaZulu-Natal (South Africa), Seychelles, Madagascar and Mascarenes east to Panama, north to Ryukyu Islands and Hawaiian islands, south to northwestern Australia and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 10 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 47.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark brown with irregular dark spots anteriorly, interspersed with lighter granulations that form diffuse crossbars on the tail.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in shallow lagoons and seaward reefs to at least 25 m., primarily in the surge zone (Ref. 9710). Lives between rocks and corals.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 0 - 25 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 255 specimens in 1 taxon.
Water temperature and chemistry ranges based on 185 samples.

Environmental ranges
  Depth range (m): 0.305 - 670
  Temperature range (°C): 5.646 - 29.336
  Nitrate (umol/L): 0.016 - 29.985
  Salinity (PPS): 32.185 - 36.148
  Oxygen (ml/l): 3.647 - 4.806
  Phosphate (umol/l): 0.086 - 2.116
  Silicate (umol/l): 0.897 - 28.121

Graphical representation

Depth range (m): 0.305 - 670

Temperature range (°C): 5.646 - 29.336

Nitrate (umol/L): 0.016 - 29.985

Salinity (PPS): 32.185 - 36.148

Oxygen (ml/l): 3.647 - 4.806

Phosphate (umol/l): 0.086 - 2.116

Silicate (umol/l): 0.897 - 28.121
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 25m.
Recorded at 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax buroensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTATTTGGTGCCTGGGCCGGGATGGTCGGCACTGCCCTAAGCCTACTAATCCGAGCCGAGCTAAGTCAACCCGGAGCCCTTCTGGGTGACGACCAAATCTACAATGTTATTGTAACAGCCCATGCGTTTGTTATAATTTTCTTTATAGTAATGCCTGTCATAATTGGAGGTTTCGGAAATTGATTAATCCCCTTAATAATTGGTGCCCCCGATATGGCATTCCCACGAATGAATAATATAAGCTTCTGGCTACTCCCCCCTTCTTTCCTGCTACTATTAGCCTCTTCCGGGGTTGAAGCCGGAGCGGGAACAGGGTGAACTGTCTACCCGCCTCTTGCAGGGAACCTGGCACATGCAGGCGCATCTGTTGACCTAACTATTTTCTCTCTCCATTTAGCAGGGGTTTCATCAATTCTAGGTGCAATTAACTTTATCACCACTATTATTAACATAAAACCCCCAGCTATCACACAATACCAAACGCCTTTATTCGTATGAGCAGTACTGGTGACAGCAGTATTACTGCTTCTCTCCCTACCAGTGGTAGCGGCGGGTATTACAATGCTTTTAACTGATCGAAACCTTAACACAACATTCTTTGATCCAGCTGGAGGCGGGGACCCAATTCTATACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax buroensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gymnothorax buroensis

Gymnothorax buroensis is a moray eel found in coral reefs in the Pacific and Indian oceans.[1] It was first named by Pieter Bleeker in 1857,[1] and is commonly known as the vagrant moray, lattice-tail moray, Buru moray eel, or the Buro moray.[2]

References

  1. ^ a b Gymnothorax buroensis at www.fishbase.org.
  2. ^ Gymnothorax buroensis at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!