Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Chauliodus sloani ZBK Bloch & Schneider, 1801

Mediterranean Sea : 31700-667 (1 spc.), 26.04.2004 , Eastern Mediterranean International waters , trawl , 400 m, C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 37-37, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits deep oceanic waters to more than 1,000 m depth; may migrate to near-surface waters at night (Ref. 4759). Up to depth of 1800 m (Ref. 47377). Depth range 473-1192 m in the eastern Ionian Sea (Ref. 56504). Meso- and bathypelagic from near the surface to 2800 m (Ref. 58302). Oviparous (Ref. 5951). Feeds on midwater fishes and crustaceans (Ref. 4759); mainly on myctophids (Ref. 5951). Lipid content is 2.4 % in fresh body weight and wax ester is 7.2 % in total lipids (Ref. 9193). Minimum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Main Reference

Gibbs RH, Jr. 1984. Chauliodontidae. In: Whitehead PJP, Bauchot M-L, Hureau J-C, Nielsen J, Tortonese E, editors. Fishes of the North-eastern Atlantic and the Mediterranean. Paris: Unesco. p 336–337.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

dorsal fin close to head, its origin over fourth to eighth photophore in lateral series; length from snout to dorsal fin origin 17–28% (usually 21–24%) SL. Color of irridescent silver-blue.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worldwide in oceanic tropical and temperate seas and as far north as West of Greenland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Warm and temperate parts of all oceans but with several distributional gaps in the southern central Atlantic, northern Indian Ocean, eastern Pacific north of the equator, etc. Also found in the western Mediterranean (Ref. 4759). South China Sea and East China Sea (Ref.74511).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Chauliodus schmidti, commonly called Sloane’s viperfish or Sloane’s fangfish, are known to inhabit almost all marine waters in the temperate and tropical zones. Their range extends from about 63 ° N to 50 ° S. There are a few regions in the Atlantic, Indian, and Pacific Ocean north of the equator where there have been no records of Sloane’s viperfish (Gibbs, 1984). Chauliodus schmidti have been found in the Mediterranean and other adjoining seas as well (Gibbs, 1984).

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

northward to 55° N in Atlantic, with records as far north as off Iceland; also, western Mediterranean. Elsewhere, widespread in Atlantic; also Indian and Pacific Oceans. Eggs, larvaeand young stages. Lo Bianco, 1902: 419–420, 422, 431 | Sanzo, 1914: 1–7 | Sanzo, 1918: 91–97 | Beebe, 1929: 10–12 | Roule and Angel, 1930: 24.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal (including Mediterranean Sea, Red Sea, Seychelles, Mascarenes, Maldives, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 5 - 8; Analspines: 0; Analsoft rays: 10 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Sloane’s fangfish are very slender with a maximum length of 35 centimeters (Gibbs, 1984). These iridescent fish come in shades of blue, green, black, or silver. Chauliodus schmidti have an adipose fin and a forked caudal fin and their dorsal fin is positioned right behind the head (Gibbs, 1984). Almost all of the fins contain soft rays. The first soft ray of the dorsal fin is elongated and extends to about half the length of the body (McGrouther, 2003). These fish have approximately 2.4 % lipid content in their body (Gibbs, 1984). This low lipid content and the fact that they vertically migrate indicate that Chauliodus schmidti probably have some form of swim bladder (Gartner, Crabtree and Sulak, 1997). Members of the genus Chauliodus are believed to eat at least once every 12 days which suggests a relatively low basal metabolic rate (Butler et al., 2001). The lower jaw protrudes beyond the upper jaw and both are lined with fang-like teeth which give the fish its common name. There are rows of 24 or more photophores (light-producing cells) along the lateral and ventral surface of the fish (Butler et al., 2001). They are not sexually dimorphic.

Range length: 35 (high) cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm SL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to more than 300 mm SL.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum Length 35 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body iridescent silver in color (Ref. 3981). Slender body, forward position of dorsal fin and greater number of serial photophores (Ref. 37473).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits deep oceanic waters to more than 1,000 m depth; may migrate to near-surface waters at night.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 200 - 4700 m (Ref. 74511), usually 494 - 1000 m (Ref. 28981)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chauliodus schmidti are primarily bathypelagic fish. The bathypelagic region extends from 1000 to 2000 meters below the surface in the open ocean. They have been collected from a maximum depth of 2800 meters (Butler et al., 2001). Chauliodus schmidti engage in asynchronous diel vertical migration which means that during the night they can be found in less deep regions such as the mesopelagic, which generally characterizes the depth range of 200 to 1000 meters (Sutton and Hopkins, 1996). It is thought that Sloane’s viperfish prefer regions of higher dissolved oxygen content because other relatives such as Chauliodus pammelas have more highly developed gills (Butler et al., 2001).

Range depth: 400 to 2800 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic

  • Sutton, T., T. Hopkins. 1996. Species composition, abundance, and vertical distribution of the stomiid (Pisces: Stomiiformes) fish assemblage of the Gulf of Mexico. Bulletin of Marine Science, 59/3: 530-542.
  • Butler, M., S. Bollens, B. Burkhalter, L. Madin, E. Horgan. 2001. Mesopelagic fishes of the Arabian Sea: distributrion, abundance and diet of Chauliodus pammelas, Chauliodus sloani, Stomias affinis, and Stomias nebulosus. Deep Sea Research Part II: Topical Stuides in Oceanography, 48/6-7: 1369-1383.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2127 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1662 samples.

Environmental ranges
  Depth range (m): 0 - 4750
  Temperature range (°C): -2.072 - 25.511
  Nitrate (umol/L): 0.762 - 45.020
  Salinity (PPS): 33.250 - 38.984
  Oxygen (ml/l): 0.139 - 7.644
  Phosphate (umol/l): 0.102 - 3.158
  Silicate (umol/l): 0.861 - 150.398

Graphical representation

Depth range (m): 0 - 4750

Temperature range (°C): -2.072 - 25.511

Nitrate (umol/L): 0.762 - 45.020

Salinity (PPS): 33.250 - 38.984

Oxygen (ml/l): 0.139 - 7.644

Phosphate (umol/l): 0.102 - 3.158

Silicate (umol/l): 0.861 - 150.398
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

deep oceanic waters to more than 1,000 m depth; may migrate to near-surface waters at night; fairly common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 494 - 1000m.
From 494 to 1000 meters.

Habitat: bathypelagic. Inhabits deep oceanic waters to more than 1,000 m depth, may migrate to near-surface waters at night. Feeds on fishes and crustaceans. Oviparous, spawns throughout the year with peak in late winter and early spring. Lipid content is 2.4 % in fresh body weight and wax ester is 7.2 % in total lipids (Ref. 9193).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on fish and crustaceans (Ref. 4759, 26338). A fish eater off Hawaii and only those fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Sloane’s viperfish have some characteristics typical of deep-water fishes which aid in acquiring food in regions of low light. These features include a straight intestine and an elongated, distensible stomach (Gartner, Crabtree and Sulak, 1997). They also have a relatively large gape, and hinged fangs. This specialized dentition can rotate inward to prevent prey from escaping and ease its passage into the gullet (Gartner, Crabtree and Sulak, 1997). Another feature that is unique to the genus Chauliodus is a hinged connection between the skull and backbone that rotates the skull upward to allow further manipulation of large prey into the throat (Gartner, Crabtree and Sulak, 1997). Chauliodus schmidti prey on a variety of nektonic, planktonic, and benthic organisms. This includes other bony fishes and crustaceans. Some examples of nektonic prey include Cyclothone, Bregmaceros, Diaphus, Lampanyctus, and Myctophum (Gibbs, 1984). Larger specimens of Sloane’s fangfish are believed to be exclusively piscivorous while the smaller or younger fish consume a higher ratio of marine arthropods (Butler et al., 2001). Chauliodus schmidti are known to be able to prey on fish that are 63 % of their own body length (Butler et al., 2001). These fish acquire food by arching their elongated first dorsal ray over the head and in front of the mouth as a lure (Gartner, Crabtree and Sulak, 1997). They may use their photophores to attract prey as well (McGrouther, 2003). As asynchronous diel migrators, they are presumed to wait at depths that act as common passages for other vertical migrators and catch prey as they ascend to feed (Gartner, Crabtree and Sulak, 1997).

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

midwater fishes and crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Sloane’s fangfish function as higher-trophic level predators in their ecosystem (Gartner, Crabtree, and Sulak, 1997). They are considered to be very important contributors to the predation on myctophids (Butler et al., 2001). Chauliodus schmidti serve as prey for the few types of organisms mentioned above.

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Chauliodus schmidti are preyed upon by larger bathy- and mesopelagic nekton. Remains of Sloane’s viperfish have been found in the stomach of Coryphaena hippurus, some mammalian dolphins (Lagenodelphis, Stenella) and various sharks (Centroscymnus, Galeus). Many species of the family Merlucciidae have been known to prey on Chauliodus schmidti as well (Gibbs, 1984). The dark colorings and lack of light at very great depths are the only known sources of protection against predators. These anti-predator characteristics couple with an asynchronous pattern of diel migration to help Chauliodus schmidti avoid being eaten (Butler et al., 2001).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on small fishes and copepods
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Since the eyes are rather large in Sloane's viperfish, it is presumed that they have retained use of sight as a form of perception (Gartner, Crabtree and Sulak, 1997). Chauliodus schmidti, like other deep-water fish, also probably make use of their bioluminescent photophores to communicate with other conspecifics (Christophe, Baguet and Marechal, 1979).

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: photic/bioluminescent

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous (Ref. 4759).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

The larvae of Chauliodus schmidti are similar in appearance to the leptocephalus of eels and are approximately 6 millimeters long when hatched. When they double in size the pectoral and caudal fins begin to develop (Gibbs, 1984). It is not known how long Chauliodus schmidti take to grow from the larval stage to the adult form.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Due to the difficulty of studying them in the wild, there is very little data on the lifespan of Sloane’s viperfish. Studies of the bands in the otoliths (plates in the inner ear) have yielded an estimated longevity of 15 to 30 years for most deep-sea fishes. However, it's difficult to know whether these bands occur strictly at annual intervals (Haedrich, 1997). Chauliodus schmidti specimens have been contained in captivity for as long as 12-18 hours (Christophe, Baguet and Marechal, 1979).

Range lifespan

Status: captivity:
12 to 18 hours.

Typical lifespan

Status: wild:
15 to 30 years.

  • Haedrich, R. 1997. Deep-Sea Fishes: Distribution and Population Ecology. San Diego: Academic Press Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Hardly anything is known about the mating system of Chauliodus schmidti. Factors such as the depth at which they live and the fact that they do not survive very long in captivity make it very difficult to study this behavior (Christophe, Baguet, and Marechal, 1979).

Very little is known about the reproductive habits of Chauliodus schmidti but like many fish they are dioecious (Gibbs, 1984). Sloane’s viperfish are not known to be sexually dimorphic since the specimens caught are rarely sexed. Since differences in species-specific photophore stimulations exist, it can be presumed that the light emissions are used in communication activities between individuals such as mate attraction (Christophe, Baguet and Marechal, 1979). Several sources have noted that external spawning takes place in this oviparous species (McGrouther, 2003). Chauliodus schmidti are low fecundity organisms (Gibbs, 1984). Spawning probably occurs year round in the species although the larvae are known to be in the highest numbers from January to March (Gibbs, 1984).

Breeding season: Year-round

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Like other types of reproductive characteristics, very little information has been gathered in respect to the parental investment of Chauliodus schmidti.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

oviparous; spawns year around, with peak in late winter and early spring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chauliodus sloani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACACGCTGATTCTTCTCCACAAACCACAAAGACATTGGCACCCTTTACTTAATCTTCGGTGCTTGGGCCGGAATAGTAGGCACTGCACTCAGCTTGCTAATTCGAGCAGAACTCAGCCAACCCGGCGCCTTCATGGGTGACGATCAAATTTACAACGTAATCGTCACAGCACATGCCTTCGTAATAATTTTCTTTATAGTTATGCCAATCATGATCGGGGGTTTCGGAAACTGATTAGTCCCCCTGATGATTGGAGCCCCTGATATGGCCTTCCCGCGAATAAACAACATGAGCTTCTGGCTACTTCCACCCTCCTTTCTTCTTCTACTTGCCTCTTCTGGGGTAGAAGCCGGGGCCGGAACTGGATGAACTGTATACCCGCCCCTTTCAGGGAACCTCGCCCACGCTGGCGCCTCCGTGGACCTTACAATTTTCTCCCTCCACCTGGCAGGGATCTCCTCTATTCTTGGAGCAATTAACTTCATTACAACCATCTACAACATGAAGCCCGCCGGCATGTCGCAATATCAGGCTCCTCTCTTTGTGTGGTCTGTTCTCATCACTGCCGTCCTTCTACTGCTCTCCCTACCCGTCTTAGCCGCCGGTATTACTATACTCCTTACAGACCGAAACCTTAACACAACCTTCTTCGACCCCGCCGGTGGAGGGGACCCCATTCTATACCAGCATCTCTTCTGATTCTTCGGTCACCCAGAGGTTTACATTCTTATTCTCCCCGGCTTCGGAATAATTTCCCACATTATTGCATACTACGCCGGCAAAAAAGAACCCTTCGGTTACATAGGAATAGCCTGAGCTATAATAGCAATTGGGCTTCTAGGCTTCATCGTATGGGCCCACCATATGTTTACCGTAGGAATGGACGTAGACACTCGTGCCTACTTCACTTCCGCTACAATAATTATTGCCATTCCAACAGGGGTCAAAGTCTTCAGCTGACTAGCTACTCTTAACGGAGGGGCCATCAAGTGGGAGACTCCTATGCTGTGGTCTCTGGGGTTCGTCTTCCTTTTTACTGTCGGGGGCTTAACTGGTATTGTCCTCGCTAACTCTTCCCTAGATATTGTACTCCACGATACCTATTATGTGGTTGCGCACTTCCATTACGTCCTATCCATGGGGGCTGTCTTTGCTATTATGGCCGGCTTCGTACATTGATTCCCGCTCTTCTCAGGCTACACCCTTCATGACACATGAACCAAGGCTCACTTCACAATTATATTCGTAGGGGTTAATCTCACCTTCTTCCCGCAGCACTTCCTGGGCCTTGCAGGAATACCTCGCCGATACTCAGACTACCCAGACGCATACACCCTTTGAAACACTGTGTCCTCGATTGGCTCCCTAATCTCGCTAGTCGCTGTTATTATGTTCCTTTACATCTTATGGGAAGCCTTCGCGTCTAAGCGGGAGGTCCTCACAGTTGAGATGGCAACTACTAATGTAGAATGACTTCATGGATGCCCTCCCCCTTACCACACATTTGAGGAGCCTGCTTTTGTCCGGATCCGTGATTAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chauliodus sloani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 54
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chauliodus schmidti are not on the IUCN Red List and are not known to have any specific conservation status (Gibbs, 1984). It would be suspected that due to the deep-water range of this stomiid, it is very difficult to characterize the overall population of this species. There is probably very little impact from humans that would cause any negative conservation status for Chauliodus schmidti.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Despite their fearsome appearance, Chauliodus schmidti are considered to be harmless to humans. As noted above, this is due to the rare occurrence of contact with humans (Gibbs, 1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Chauliodus schmidti have no known positive impact on humans. Their deep water range limits any type of contact with humans on a regular basis other than the few that are caught in deep water trawls. Since they are among the most common stomiids caught, they provide an opportunity for research on bioluminescence in the deep sea and the behavior of other deep-sea fish (Sutton and Hopkins, 1996).

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sloane's viperfish

Sloane's viperfish, Chauliodus sloani, is a dragonfish of the genus Chauliodus, found in all tropical and subtropical oceans, at depths down to 2,500 m. Their length is between 20 and 35 cm.

As a species, Sloane's viperfish holds the world record for largest teeth relative to head size in a fish. It has teeth so large it must open its mouth to make the jaws vertical before it can swallow prey. When the mouth is closed, the teeth overlap the jaws. It eats large prey by lowering the internal skeleton of the gills, allowing the prey to pass into the throat without interference. It can impale prey on the teeth by swimming at them with the first vertebra behind the head acting as a shock absorber. Sloan's viperfish is approximately 28 cm (11 in) long. Its head is about 2 cm (0.8 in) and its teeth are just over half this length.[1]

References[edit]

  1. ^ Guinness Book of World Records, Guinness Book of World Records 2011.
Messina Straits Chauliodus sloani.jpg
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!