Overview

Comprehensive Description

Biology

Euryhaline species (Ref. 58920). Adults migrate to freshwater to spawn (Ref. 58920).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

T. obscurus is found in the northwest Pacific Ocean (East and South China Seas), and also in inland waters in China and the Korean Peninsula.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: East China Sea and the South China Sea. Found in rivers in China and the Korean Peninsula.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 15 - 19; Analspines: 0; Analsoft rays: 13 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body covered with prickles. A large black blotch on side beneath pectoral fin and on base of dorsal fin (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
T. obscurus is an anadromous and demersal species.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 58920); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Euryhaline species (Ref. 58920). Most of the growth takes place in the sea but they spawn in brackish and fresh water(Ref. 58920).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Takifugu obscurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAATCACAAAGACATCGGCACCCTATACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGCACAGCACTAAGTCTTCTTATTCGGGCCGAACTCAGTCAACCCGGCGCACTCTTGGGCGATGACCAGATCTACAATGTAATCGTTACAGCCCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGGAACTGATTAGTTCCCCTTATAATCGGAGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTTCTGCTCGCATCCTCTGGAGTAGAAGCCGGAGCGGGTACGGGCTGAACGGTTTACCCACCCCTAGCAGGAAATCTTGCCCACGCAGGAGCTTCTGTAGACCTCACCATCTTCTCTCTTCATCTTGCAGGGGTCTCCTCTATTTTAGGGGCAATCAACTTCATCACAACTATCATTAACATGAAACCCCCAGCAATCTCACAATACCAAACACCTCTTTTCGTGTGAGCCGTTTTAATTACTGCTGTACTTCTCCTGCTCTCCCTTCCAGTCCTTGCAGCAGGGATTACAATACTTCTCACTGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTGTACCAGCACTTATTCTGATTCTTTGGCCACCCTGAAGCCTACATTCTTATTCTCCCTGGCTTCGGGATAATTTCACATATCGTAGCCTACTACTCGGGCAAAAAAGAACCATTCGGTTACATGGGCATGGTCTGAGCCATGATGGCCATTGGTCTTCTTGGCTTTATTGTATGAGCCCACCACATGTTTACAGTCGGCATGGACGTAGACACCCGAGCCTACTTTACCTCCGCCACAATAATTATTGCCATCCCGACAGGAGTCAAAGTATTTAGCTGACTTGCAACCTTGCATGGAGGATCAATCAAATGAGAAACCCCTATACTATGAGCCCTCGGCTTCATCTTCCTATTTACAGTGGGCGGCCTAACCGGAATTGTCCTGGCCAACTCATCCCTAGACATCGTTTTACACGACACCTACTACGTAGTTGCCCATTTCCACTATGTCCTCTCCATGGGTGCTGTATTTGCAATTATGGGTGCATTCGTACACTGATTCCCACTATTTTCAGGATACACACTCCACAGCACTTGAACTAAAATCCACTTTGGAGTAATGTTCATTGGTGTCAACCTAACCTTCTTCCCCCAACACTTCCTTGGTCTAGCTGGGATACCTCGACGATACTCCGACTACCCCGACGCCTACGCCCTATGAAACTCCGTCTCCTCAATTGGCTCAATAGTCTCTCTAGTGGCAGTAATTATGTTCCTCTTTATCCTCTGAGAAGCCTTCACCGCCAAGCGAGAAGTCCAATCAGTTGAACTAACAATGACGAATGTAGAATGACTACACGGGTGCCCTCCTCCTTACCATACATTCGAAGAGCCCGCCTTCGTCCAAACTCAAACCTCTGTCCGAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Takifugu obscurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Devi, R. & Boguskaya, N.

Reviewer/s
Collen, B., Darwall, W., Ram, M. & Smith, K. (SRLI Freshwater Fish Evaluation Workshop)

Contributor/s

Justification
T. obscurus is utilised for human food, the aquarium trade, and use in scientific research. Currently T. obscurus has a wide range so is not classified as a threatened category, however exploitation may cause population declines on the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Detailed population information is lacking for this species although it is noted to be stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no threats currently known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is not known if there are any conservation measures in place or needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquaculture: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!