Overview

Comprehensive Description

Biology

Euryhaline species (Ref. 58920). Adults migrate to freshwater to spawn (Ref. 58920).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

In the Western Pacific, Takifugu obscurus is known from the Yellow Sea, East China Sea and South China Sea south to the Korean Peninsula. It is found in rivers in China (Nakabo 2002). It is found to depths of at least 20 m, and may be found deeper.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: East China Sea and the South China Sea. Found in rivers in China and the Korean Peninsula.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 15 - 19; Analspines: 0; Analsoft rays: 13 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body covered with prickles. A large black blotch on side beneath pectoral fin and on base of dorsal fin (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Takifugu obscurus is a demersal, anadromous species which undergoes annual seasonal migrations into freshwater systems to spawn. In the Yangtze River basin, the spawning period for T. obscurus is from March until April. This species maintains a sex ratio of approximately 1: 1. This species reaches sexual maturity between 25 and 28 cm (SL). The ovaries and blood are extremely toxic, while the liver, skin, and intestine are highly toxic. The flesh and testes are innocuous (Nakabo 2002).

This species lives in the bottom layer of inshore and inland waters, and grows 2040 cm in length. Most of the growth takes place in the sea but they spawn in brackish and fresh water. During the spawning season, which is from late spring to early summer, the sexually mature fish run into river estuaries and spawn in inland waters including rivers, lakes, and ponds. The fingerlings grow in the inland water and either return to the sea the next spring or they there for a few months before returning to the sea. In the sea they grow to sexually mature fish over several years, and then return to the inland water again to spawn (Kato et al. 2005).


Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 58920); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Euryhaline species (Ref. 58920). Most of the growth takes place in the sea but they spawn in brackish and fresh water(Ref. 58920).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Takifugu obscurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAATCACAAAGACATCGGCACCCTATACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGCACAGCACTAAGTCTTCTTATTCGGGCCGAACTCAGTCAACCCGGCGCACTCTTGGGCGATGACCAGATCTACAATGTAATCGTTACAGCCCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGGAACTGATTAGTTCCCCTTATAATCGGAGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTTCTGCTCGCATCCTCTGGAGTAGAAGCCGGAGCGGGTACGGGCTGAACGGTTTACCCACCCCTAGCAGGAAATCTTGCCCACGCAGGAGCTTCTGTAGACCTCACCATCTTCTCTCTTCATCTTGCAGGGGTCTCCTCTATTTTAGGGGCAATCAACTTCATCACAACTATCATTAACATGAAACCCCCAGCAATCTCACAATACCAAACACCTCTTTTCGTGTGAGCCGTTTTAATTACTGCTGTACTTCTCCTGCTCTCCCTTCCAGTCCTTGCAGCAGGGATTACAATACTTCTCACTGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTGTACCAGCACTTATTCTGATTCTTTGGCCACCCTGAAGCCTACATTCTTATTCTCCCTGGCTTCGGGATAATTTCACATATCGTAGCCTACTACTCGGGCAAAAAAGAACCATTCGGTTACATGGGCATGGTCTGAGCCATGATGGCCATTGGTCTTCTTGGCTTTATTGTATGAGCCCACCACATGTTTACAGTCGGCATGGACGTAGACACCCGAGCCTACTTTACCTCCGCCACAATAATTATTGCCATCCCGACAGGAGTCAAAGTATTTAGCTGACTTGCAACCTTGCATGGAGGATCAATCAAATGAGAAACCCCTATACTATGAGCCCTCGGCTTCATCTTCCTATTTACAGTGGGCGGCCTAACCGGAATTGTCCTGGCCAACTCATCCCTAGACATCGTTTTACACGACACCTACTACGTAGTTGCCCATTTCCACTATGTCCTCTCCATGGGTGCTGTATTTGCAATTATGGGTGCATTCGTACACTGATTCCCACTATTTTCAGGATACACACTCCACAGCACTTGAACTAAAATCCACTTTGGAGTAATGTTCATTGGTGTCAACCTAACCTTCTTCCCCCAACACTTCCTTGGTCTAGCTGGGATACCTCGACGATACTCCGACTACCCCGACGCCTACGCCCTATGAAACTCCGTCTCCTCAATTGGCTCAATAGTCTCTCTAGTGGCAGTAATTATGTTCCTCTTTATCCTCTGAGAAGCCTTCACCGCCAAGCGAGAAGTCCAATCAGTTGAACTAACAATGACGAATGTAGAATGACTACACGGGTGCCCTCCTCCTTACCATACATTCGAAGAGCCCGCCTTCGTCCAAACTCAAACCTCTGTCCGAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Takifugu obscurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Hardy, G., Matsuura, K., Shao, K., Jing, L., Leis, J.L. & Liu, M.

Reviewer/s
Zapfe, G. & Lyczkowski-Shultz, J.

Contributor/s
Stump, E.

Justification
Takifugu obscurus is known from the Yellow Sea, East China Sea and South China Sea to the Korean Peninsula. It is found in rivers in China. It is found at depths ranging from one to at least 20 m. This is a euryhaline species which lives in the bottom layer of inshore and inland waters. Spawning occurs in estuaries, and this species is known to migrate into freshwater to spawn. It is a commercial species which is considered highly-valued, however there is little information available to characterize the fishery. This species has been bred in captivity, and it is unclear whether or not this effort has been for the purposes of stock enhancement. There is little species-specific population information available. This species' dependence on freshwater systems to spawn and its predictable, seasonal mass spawning migrations into freshwater systems render it particularly vulnerable to overfishing. Seasonal fishing prohibitions and the presence of both fresh and marine water preserves in parts of its range may offer this species some protection. Takifugu obscurus is assessed as Least Concern.

History
  • 2009
    Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is little species-specific population information available for wild populations ofT. obscurus.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There have been no confirmed population declines inT. obscurus. However, it is likely to be impacted by the following:

Fugu fishery
The Fugu fishery is acknowledged to have undergone significant declines throughout East Asia. Highly effective fishing gear, including modified long-lines and nets with small mesh sizes, rather than excessive fishing effort, have been implicated in the depletion of Takifugu pufferfish resources in parts of East Asia. In Japan, initial efforts to regulate the fishery in the mid-2000s had not achieved desired results by 2010, and were subsequently re-evaluated (Kawata 2012). Although the species-specific effects of the Fugu fishery onT. obscurusare unknown, it is likely that populations of this minor commercial species are impacted by this fishery.

Genetic effects of cultured fish on natural populations
Fishes of the genusTakifuguhave become the focus of increasing aquaculture efforts throughout East Asia. AquaculturedTakifuguare used to meet increasing demand for pufferfish products and to enhance natural populations which have been depleted throughout the region (Kawataet al. 2012). As culture fish are genetically distinct from natural populations, the release of aqua-cultured fish can result in a range of genetic outcomes, from no detectable effect to complete introgression or displacement of wild populations (Hindaret al. 1991). Fishes of the genusTakifuguare relatively recently diverged, and each combination ofTakifuguspecies is expected to produce fertile hybrid crosses (Yamanoueet al. 2008). It is therefore likely that the effect of intentional and unintentional release of culturedTakifuguon the genetic integrity of wild populations is significant.

Regional threats: environmental degradation and over-fishing
Major threats to biodiversity of the China seas include over-exploitation of fishery resources and environmental deterioration. The China Seas have faced severe environmental degradation due to a range of anthropogenic activities within a relatively recent and short time frame (Daoji and Daler 2004). The degradation of estuarine environments due to pollution and coastal production is of particular concern, as these areas are characterized by high productivity and represent spawning and nursery areas for many species (Liu 2013). Large areas of the China Seas (Liu 2013) and the Gulf of Thailand (Blaber 2000) are considered to be heavily overfished. Additionally, heavy bottom-trawling in the 1980s and the widespread use of modified driftnets for multi-species fisheries in the Bohai Sea, combined with other anthropogenic stresses, have been implicated in the steady decrease in fish landings in this area (Xianshi 2004). In the Yellow Sea, previously dominant large demersal species became the targets of heavy fishing pressure during the 1950s and 1960s and greatly declined in abundance. By the 1980s, many large pelagic species were also showing great declines in abundance, and since that time the dominant species in the Yellow Sea have been small, planktivorous pelagic species, such as anchovies and sardines (Jin and Tang 1996). In the Yellow Sea, all ecological indexes such as the species number, species richness, species diversity and the evenness were lower in the year 2000 than in the year 1985 (Linet al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no known species-specific conservation measures in place forT. obscurus,however, it is possible that management efforts aimed at sustainingT. rubripesfisheries have benefitedT. obscurus. Additionally,T. obscurushas been bred in captivity to meet increasing demand and to enhance existing stocks.

Fugu fishery
The Fugu fishery is acknowledged to have undergone significant declines. Japan, South Korea and China previously operated their fisheries under a policy which prevented the regulation of foreign fishing vessels and treated the open sea in East Asia as common property. Since 1999, with the ratification of the United Nations (UN) Convention on the Law of the Sea and new fishery agreements between these nations, this policy has shifted to enable coastal countries to regulate foreign fishing vessels. As a result of this policy shift, Japan announced the Plan for Rebuilding Puffer Resources in April 2005, which set dates for an off-fishing season, restrictions on minimum body size, support for stock-enhancement programs, improvements to fishing grounds, and mandated the release of small fishes. As of 2010, stocks had not fully improved, prompting a re-assessment of the program. Several recommendations have been made in order to ensure its continued existence, particularly in light of socio-economic constraints which limit the possibility of developing alternative fisheries. Recommendations include gear restrictions and mandating that fishers catch older and heavier fish by postponing the beginning of the fishing season (Kamara 2012).

In order to sustain fisheries of the East China Sea, the government of China has implemented a number of management and conservation measures. These include establishing a prohibited-fishing zone along the 50-m depth contour, the establishment of seventeen national nature reserves and five special marine protected areas, the creation of fishery protected areas which are annually closed to trawling, and a summer closed-fishing areas, which prohibit trawling and have been extended to the South China Sea, Yellow Sea, and Bohai Sea (Chenget al.2007).

Takifugu obscuruscan be found in both freshwater and marine protected areas. According to the protection regulations for wetlands in the Poyang Lake of Jiangxi Province (2004) and the implementation of Chinese Fishery Lawin Jiangxi Province (1987), fishing is is banned from March 20th to June 20th every year in Poyang Lake. This corresponds with the spawning migration of this species in China, although whether or not this species spawns in the lake is unknown. Fishing has also been banned for two months from June 1st to July 31st each year since 1987 along the Xiajiang reach, Xingan reach, Jishui reach and Jian reach of the Ganjiang River, where this species has been recorded. However, this does not correspond to the freshwater spawning migration of this species (Huanget al.2010).

Further research
The economically important genusTakifuguhas been recommended for further taxonomic studies based on morphological and molecular analyses (Yamanoueet al.2008), and we support this recommendation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquaculture: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!